Incidental Mutation 'R2286:Kremen1'
ID243308
Institutional Source Beutler Lab
Gene Symbol Kremen1
Ensembl Gene ENSMUSG00000020393
Gene Namekringle containing transmembrane protein 1
SynonymsKrm1
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R2286 (G1)
Quality Score158
Status Not validated
Chromosome11
Chromosomal Location5191552-5261558 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CGGG to CGGGGGG at 5201791 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020662]
Predicted Effect probably benign
Transcript: ENSMUST00000020662
SMART Domains Protein: ENSMUSP00000020662
Gene: ENSMUSG00000020393

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
KR 30 116 9.81e-23 SMART
Pfam:WSC 119 200 3.7e-21 PFAM
CUB 214 321 4.27e-19 SMART
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151978
SMART Domains Protein: ENSMUSP00000121252
Gene: ENSMUSG00000020393

DomainStartEndE-ValueType
Pfam:WSC 17 98 2.3e-22 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor that functionally cooperates with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein is a component of a membrane complex that modulates canonical WNT signaling through lipoprotein receptor-related protein 6 (LRP6). It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Alox5ap G A 5: 149,285,430 probably null Het
Ap2s1 T C 7: 16,748,976 V131A possibly damaging Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Cpsf7 T C 19: 10,535,296 L248P probably damaging Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Dtd1 T C 2: 144,635,866 probably null Het
Eci1 A G 17: 24,433,229 D75G probably damaging Het
Luc7l A G 17: 26,280,046 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Rsad2 T A 12: 26,450,676 N204I probably benign Het
Setd5 T G 6: 113,119,610 N592K possibly damaging Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Slc39a5 A G 10: 128,396,060 V532A probably benign Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Kremen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Kremen1 APN 11 5199667 missense probably benign 0.00
R0038:Kremen1 UTSW 11 5207703 splice site probably benign
R0511:Kremen1 UTSW 11 5215447 missense probably damaging 1.00
R1557:Kremen1 UTSW 11 5215373 splice site probably null
R1579:Kremen1 UTSW 11 5201791 unclassified probably benign
R1729:Kremen1 UTSW 11 5201791 unclassified probably benign
R1784:Kremen1 UTSW 11 5201792 unclassified probably benign
R1800:Kremen1 UTSW 11 5201791 unclassified probably benign
R2079:Kremen1 UTSW 11 5201794 frame shift probably null
R2100:Kremen1 UTSW 11 5201788 unclassified probably benign
R2298:Kremen1 UTSW 11 5201788 unclassified probably benign
R2352:Kremen1 UTSW 11 5201791 unclassified probably benign
R2512:Kremen1 UTSW 11 5201791 unclassified probably benign
R2761:Kremen1 UTSW 11 5201792 unclassified probably benign
R2846:Kremen1 UTSW 11 5201793 unclassified probably benign
R2882:Kremen1 UTSW 11 5201791 unclassified probably benign
R2944:Kremen1 UTSW 11 5201791 unclassified probably benign
R2980:Kremen1 UTSW 11 5201794 unclassified probably benign
R3151:Kremen1 UTSW 11 5195012 missense probably damaging 0.99
R3610:Kremen1 UTSW 11 5201791 unclassified probably benign
R3831:Kremen1 UTSW 11 5201794 unclassified probably benign
R3957:Kremen1 UTSW 11 5201791 unclassified probably benign
R4231:Kremen1 UTSW 11 5243881 nonsense probably null
R4397:Kremen1 UTSW 11 5199610 missense probably benign 0.36
R5627:Kremen1 UTSW 11 5199709 missense probably benign 0.01
R6818:Kremen1 UTSW 11 5195051 missense probably benign 0.02
R7584:Kremen1 UTSW 11 5194964 missense possibly damaging 0.95
T0975:Kremen1 UTSW 11 5195105 missense probably benign 0.02
Y4339:Kremen1 UTSW 11 5201791 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTAGCTGAGTCAGGAGG -3'
(R):5'- AACTACTCAGCCATGGCAGC -3'

Sequencing Primer
(F):5'- TCAGGAGGACCAAGTGTGCC -3'
(R):5'- ATGGCAGCCGTGGTGTACTC -3'
Posted On2014-10-16