Incidental Mutation 'R2286:Eci1'
ID243315
Institutional Source Beutler Lab
Gene Symbol Eci1
Ensembl Gene ENSMUSG00000024132
Gene Nameenoyl-Coenzyme A delta isomerase 1
SynonymsDci, eci
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R2286 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24426683-24439316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24433229 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 75 (D75G)
Ref Sequence ENSEMBL: ENSMUSP00000024946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024946]
Predicted Effect probably damaging
Transcript: ENSMUST00000024946
AA Change: D75G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024946
Gene: ENSMUSG00000024132
AA Change: D75G

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:ECH_1 39 288 3.2e-96 PFAM
Pfam:ECH_2 44 289 5.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruption of this gene are normal until stressed. Starvation results in increased accumulation of triglycerides and unsaturated fatty acids in the liver and kidney. Secretion of fatty acid metabolites in the urine is greatly increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Alox5ap G A 5: 149,285,430 probably null Het
Ap2s1 T C 7: 16,748,976 V131A possibly damaging Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Cpsf7 T C 19: 10,535,296 L248P probably damaging Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Dtd1 T C 2: 144,635,866 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Luc7l A G 17: 26,280,046 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Rsad2 T A 12: 26,450,676 N204I probably benign Het
Setd5 T G 6: 113,119,610 N592K possibly damaging Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Slc39a5 A G 10: 128,396,060 V532A probably benign Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Eci1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03123:Eci1 APN 17 24436326 critical splice donor site probably null
R0391:Eci1 UTSW 17 24433260 splice site probably null
R1535:Eci1 UTSW 17 24439090 missense probably benign 0.32
R1749:Eci1 UTSW 17 24426747 splice site probably null
R4179:Eci1 UTSW 17 24436277 missense probably damaging 1.00
R5656:Eci1 UTSW 17 24437309 missense probably damaging 1.00
R6508:Eci1 UTSW 17 24437309 missense probably damaging 1.00
R7062:Eci1 UTSW 17 24426740 unclassified probably benign
R7771:Eci1 UTSW 17 24433151 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCAGCTCCTATCTGAACAG -3'
(R):5'- AAAGCCTGGAAACCTGCTTTC -3'

Sequencing Primer
(F):5'- TGCAGTTACTGTAGCCAGAC -3'
(R):5'- CTCCAGATCTTCCAGGTT -3'
Posted On2014-10-16