Incidental Mutation 'R2286:Luc7l'
ID243316
Institutional Source Beutler Lab
Gene Symbol Luc7l
Ensembl Gene ENSMUSG00000024188
Gene NameLuc7-like
Synonyms
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R2286 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26252910-26285504 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 26280046 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025023] [ENSMUST00000114976] [ENSMUST00000119928] [ENSMUST00000140427] [ENSMUST00000148894] [ENSMUST00000152107] [ENSMUST00000154235]
Predicted Effect unknown
Transcript: ENSMUST00000025023
AA Change: R298G
SMART Domains Protein: ENSMUSP00000025023
Gene: ENSMUSG00000024188
AA Change: R298G

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114976
AA Change: R298G
SMART Domains Protein: ENSMUSP00000110627
Gene: ENSMUSG00000024188
AA Change: R298G

DomainStartEndE-ValueType
Pfam:LUC7 5 249 2.5e-85 PFAM
low complexity region 327 336 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119928
AA Change: R298G
SMART Domains Protein: ENSMUSP00000113405
Gene: ENSMUSG00000024188
AA Change: R298G

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133032
Predicted Effect probably benign
Transcript: ENSMUST00000140427
SMART Domains Protein: ENSMUSP00000122258
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 1 168 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148894
Predicted Effect unknown
Transcript: ENSMUST00000152107
AA Change: R97G
SMART Domains Protein: ENSMUSP00000119717
Gene: ENSMUSG00000024188
AA Change: R97G

DomainStartEndE-ValueType
coiled coil region 8 55 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154235
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The LUC7L gene may represent a mammalian heterochromatic gene, encoding a putative RNA-binding protein similar to the yeast Luc7p subunit of the U1 snRNP splicing complex that is normally required for 5-prime splice site selection (Tufarelli et al., 2001 [PubMed 11170747]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a mutant allele producing a truncated product lacked any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Alox5ap G A 5: 149,285,430 probably null Het
Ap2s1 T C 7: 16,748,976 V131A possibly damaging Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Cpsf7 T C 19: 10,535,296 L248P probably damaging Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Dtd1 T C 2: 144,635,866 probably null Het
Eci1 A G 17: 24,433,229 D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Rsad2 T A 12: 26,450,676 N204I probably benign Het
Setd5 T G 6: 113,119,610 N592K possibly damaging Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Slc39a5 A G 10: 128,396,060 V532A probably benign Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Luc7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Luc7l APN 17 26279340 utr 3 prime probably benign
IGL02141:Luc7l APN 17 26253080 missense probably damaging 1.00
R0658:Luc7l UTSW 17 26266322 missense probably damaging 1.00
R1114:Luc7l UTSW 17 26275858 splice site probably benign
R1868:Luc7l UTSW 17 26280056 utr 3 prime probably benign
R2112:Luc7l UTSW 17 26255127 critical splice donor site probably null
R2864:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R2865:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R3040:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4319:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4384:Luc7l UTSW 17 26279962 splice site probably benign
R5160:Luc7l UTSW 17 26267297 missense probably benign 0.27
R5330:Luc7l UTSW 17 26275733 nonsense probably null
R5331:Luc7l UTSW 17 26275733 nonsense probably null
R7220:Luc7l UTSW 17 26253245 start gained probably benign
R7418:Luc7l UTSW 17 26253182 unclassified probably benign
R7559:Luc7l UTSW 17 26255115 missense probably damaging 1.00
R8077:Luc7l UTSW 17 26255073 missense probably damaging 1.00
R8203:Luc7l UTSW 17 26266359 missense possibly damaging 0.95
X0026:Luc7l UTSW 17 26277575 missense probably damaging 1.00
Z1088:Luc7l UTSW 17 26267255 missense probably damaging 0.96
Z1177:Luc7l UTSW 17 26281661 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCTGAAGGCCAATAGATGCTG -3'
(R):5'- TGCTAGTCACCCAGAACCTG -3'

Sequencing Primer
(F):5'- GGCCAATAGATGCTGAGAGTTG -3'
(R):5'- GTCCCTACCAGATGTAATGGC -3'
Posted On2014-10-16