Mutagenetix > Incidental Mutation

Incidental Mutation 'R2286:Vmn2r120'

243317

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r120

Ensembl Gene

ENSMUSG00000090655

Gene Name

vomeronasal 2, receptor 120

Synonyms

EG224916

MMRRC Submission

040285-MU

Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R2286 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57508783-57545314 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57508958 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 799 (L799P)

Ref Sequence

ENSEMBL: ENSMUSP00000129296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165781]

AlphaFold

A0A3Q4EG79

Predicted Effect

probably damaging
Transcript: ENSMUST00000165781
AA Change: L799P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: L799P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	80	474	5.9e-42	PFAM
Pfam:NCD3G	517	570	7.5e-22	PFAM
Pfam:7tm_3	598	836	1.3e-54	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	C	T	5: 8,145,616	R308H	probably damaging	Het
Alox5ap	G	A	5: 149,285,430		probably null	Het
Ap2s1	T	C	7: 16,748,976	V131A	possibly damaging	Het
Cdr2l	GAA	GA	11: 115,392,800		probably null	Het
Cpsf7	T	C	19: 10,535,296	L248P	probably damaging	Het
Dscr3	C	T	16: 94,512,253	E60K	possibly damaging	Het
Dtd1	T	C	2: 144,635,866		probably null	Het
Eci1	A	G	17: 24,433,229	D75G	probably damaging	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Luc7l	A	G	17: 26,280,046		probably benign	Het
Med13	A	C	11: 86,319,689	D542E	probably benign	Het
Myo6	T	C	9: 80,266,212	S545P	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Olfr1281	A	G	2: 111,328,907	I163V	probably benign	Het
Rsad2	T	A	12: 26,450,676	N204I	probably benign	Het
Setd5	T	G	6: 113,119,610	N592K	possibly damaging	Het
Sgip1	G	T	4: 102,867,647	S59I	possibly damaging	Het
Slc39a5	A	G	10: 128,396,060	V532A	probably benign	Het
Smarcc2	G	A	10: 128,463,743	M123I	possibly damaging	Het
Tdrd1	A	G	19: 56,839,119	T185A	probably benign	Het
Tnn	T	C	1: 160,110,509	E1146G	possibly damaging	Het
Unc13a	T	C	8: 71,630,559	K1618E	probably damaging	Het

Other mutations in Vmn2r120

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Vmn2r120	APN	17	57525732	missense	possibly damaging	0.86
IGL01346:Vmn2r120	APN	17	57545232	missense	probably benign	0.11
IGL01996:Vmn2r120	APN	17	57525222	missense	possibly damaging	0.92
IGL02503:Vmn2r120	APN	17	57509385	missense	probably benign	0.40
IGL02582:Vmn2r120	APN	17	57524724	missense	probably damaging	0.99
IGL02747:Vmn2r120	APN	17	57524719	missense	probably benign	0.19
IGL02896:Vmn2r120	APN	17	57509008	missense	probably damaging	1.00
IGL03139:Vmn2r120	APN	17	57524742	missense	probably benign	0.39
IGL03342:Vmn2r120	APN	17	57509372	missense	probably benign	0.03
A4554:Vmn2r120	UTSW	17	57525715	missense	probably benign	0.01
R0207:Vmn2r120	UTSW	17	57525052	missense	probably benign	0.17
R0472:Vmn2r120	UTSW	17	57524518	missense	probably benign	0.03
R0517:Vmn2r120	UTSW	17	57508949	missense	probably damaging	1.00
R1109:Vmn2r120	UTSW	17	57525829	missense	probably benign	0.09
R1316:Vmn2r120	UTSW	17	57525939	missense	probably benign	0.28
R1543:Vmn2r120	UTSW	17	57522374	missense	probably benign	0.09
R1795:Vmn2r120	UTSW	17	57525038	missense	probably benign	0.35
R1850:Vmn2r120	UTSW	17	57525826	missense	probably benign	0.19
R1920:Vmn2r120	UTSW	17	57524839	missense	probably benign	0.01
R1921:Vmn2r120	UTSW	17	57524839	missense	probably benign	0.01
R1922:Vmn2r120	UTSW	17	57524839	missense	probably benign	0.01
R2063:Vmn2r120	UTSW	17	57524553	missense	possibly damaging	0.88
R2064:Vmn2r120	UTSW	17	57524553	missense	possibly damaging	0.88
R2065:Vmn2r120	UTSW	17	57524553	missense	possibly damaging	0.88
R2067:Vmn2r120	UTSW	17	57524553	missense	possibly damaging	0.88
R2291:Vmn2r120	UTSW	17	57509479	missense	probably damaging	1.00
R3416:Vmn2r120	UTSW	17	57509241	missense	possibly damaging	0.89
R3874:Vmn2r120	UTSW	17	57524954	missense	probably benign	0.40
R4023:Vmn2r120	UTSW	17	57536718	missense	possibly damaging	0.92
R4024:Vmn2r120	UTSW	17	57536718	missense	possibly damaging	0.92
R4348:Vmn2r120	UTSW	17	57522466	missense	possibly damaging	0.47
R4409:Vmn2r120	UTSW	17	57509477	missense	probably damaging	1.00
R4610:Vmn2r120	UTSW	17	57509120	missense	probably damaging	1.00
R4771:Vmn2r120	UTSW	17	57524887	missense	probably damaging	1.00
R4786:Vmn2r120	UTSW	17	57522048	missense	probably benign	0.14
R4927:Vmn2r120	UTSW	17	57509125	missense	probably damaging	1.00
R5285:Vmn2r120	UTSW	17	57536703	missense	probably damaging	1.00
R5566:Vmn2r120	UTSW	17	57545290	missense	possibly damaging	0.95
R5578:Vmn2r120	UTSW	17	57522514	missense	probably benign	0.01
R5643:Vmn2r120	UTSW	17	57524977	missense	probably benign	0.01
R5644:Vmn2r120	UTSW	17	57524977	missense	probably benign	0.01
R5781:Vmn2r120	UTSW	17	57524938	missense	probably benign	0.00
R6084:Vmn2r120	UTSW	17	57525721	missense	probably benign	0.15
R6120:Vmn2r120	UTSW	17	57525973	missense	probably benign	0.02
R6160:Vmn2r120	UTSW	17	57509418	missense	probably benign	0.03
R6248:Vmn2r120	UTSW	17	57545287	missense	probably benign	0.03
R6256:Vmn2r120	UTSW	17	57524700	nonsense	probably null
R6730:Vmn2r120	UTSW	17	57525012	missense	probably benign	0.03
R6821:Vmn2r120	UTSW	17	57536659	missense	probably benign	0.00
R6868:Vmn2r120	UTSW	17	57545218	missense	probably benign	0.00
R6880:Vmn2r120	UTSW	17	57509187	missense	probably damaging	1.00
R6986:Vmn2r120	UTSW	17	57509340	missense	probably damaging	1.00
R7276:Vmn2r120	UTSW	17	57524881	missense	probably benign	0.11
R7373:Vmn2r120	UTSW	17	57509406	missense	probably benign	0.35
R7653:Vmn2r120	UTSW	17	57509258	missense	possibly damaging	0.93
R7667:Vmn2r120	UTSW	17	57536657	missense	probably benign	0.04
R7775:Vmn2r120	UTSW	17	57525942	missense	probably damaging	1.00
R7778:Vmn2r120	UTSW	17	57525942	missense	probably damaging	1.00
R7797:Vmn2r120	UTSW	17	57508874	missense	probably damaging	1.00
R7824:Vmn2r120	UTSW	17	57525942	missense	probably damaging	1.00
R7902:Vmn2r120	UTSW	17	57509244	missense	possibly damaging	0.87
R7922:Vmn2r120	UTSW	17	57524683	missense	probably damaging	0.99
R8508:Vmn2r120	UTSW	17	57525843	missense	probably benign	0.03
R8847:Vmn2r120	UTSW	17	57509217	missense	probably benign	0.01
R8882:Vmn2r120	UTSW	17	57545229	missense	probably benign	0.01
R9134:Vmn2r120	UTSW	17	57525093	missense	probably damaging	1.00
R9161:Vmn2r120	UTSW	17	57524864	missense
R9336:Vmn2r120	UTSW	17	57525201	missense	possibly damaging	0.91
RF005:Vmn2r120	UTSW	17	57521991	missense	possibly damaging	0.65
Z1177:Vmn2r120	UTSW	17	57509245	missense	probably benign	0.00
Z1188:Vmn2r120	UTSW	17	57522436	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGACATGTAAGGCAATCTTG -3'
(R):5'- GCCACATCACCATCATGTGC -3'

Sequencing Primer
(F):5'- GCATACTGAATATTTCACTTGCACAC -3'
(R):5'- TGCAACAAGGGATCCGCTACTG -3'

Posted On

2014-10-16