Incidental Mutation 'R2286:Cpsf7'
ID243318
Institutional Source Beutler Lab
Gene Symbol Cpsf7
Ensembl Gene ENSMUSG00000034820
Gene Namecleavage and polyadenylation specific factor 7
SynonymsC330017N18Rik, 5730453I16Rik
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2286 (G1)
Quality Score204
Status Not validated
Chromosome19
Chromosomal Location10525244-10547735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10535296 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 248 (L248P)
Ref Sequence ENSEMBL: ENSMUSP00000038958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038379] [ENSMUST00000123788] [ENSMUST00000145210]
Predicted Effect probably damaging
Transcript: ENSMUST00000038379
AA Change: L248P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038958
Gene: ENSMUSG00000034820
AA Change: L248P

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
RRM 83 158 7.31e-8 SMART
low complexity region 188 202 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 265 291 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 405 439 N/A INTRINSIC
low complexity region 454 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123788
SMART Domains Protein: ENSMUSP00000119596
Gene: ENSMUSG00000024667

DomainStartEndE-ValueType
Pfam:Transmemb_17 15 123 9.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145210
SMART Domains Protein: ENSMUSP00000123397
Gene: ENSMUSG00000024667

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 69 2.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Alox5ap G A 5: 149,285,430 probably null Het
Ap2s1 T C 7: 16,748,976 V131A possibly damaging Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Dtd1 T C 2: 144,635,866 probably null Het
Eci1 A G 17: 24,433,229 D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Luc7l A G 17: 26,280,046 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Rsad2 T A 12: 26,450,676 N204I probably benign Het
Setd5 T G 6: 113,119,610 N592K possibly damaging Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Slc39a5 A G 10: 128,396,060 V532A probably benign Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Cpsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cpsf7 APN 19 10539787 missense probably damaging 0.98
IGL00870:Cpsf7 APN 19 10539650 splice site probably null
IGL01883:Cpsf7 APN 19 10526023 missense possibly damaging 0.69
IGL02406:Cpsf7 APN 19 10531988 missense probably damaging 0.96
IGL02491:Cpsf7 APN 19 10539637 missense possibly damaging 0.92
IGL02990:Cpsf7 APN 19 10531795 missense probably benign
R0003:Cpsf7 UTSW 19 10539629 missense possibly damaging 0.88
R0540:Cpsf7 UTSW 19 10533318 nonsense probably null
R0633:Cpsf7 UTSW 19 10531782 missense probably benign 0.09
R0662:Cpsf7 UTSW 19 10526008 start codon destroyed probably null 0.77
R1309:Cpsf7 UTSW 19 10533467 critical splice donor site probably null
R1817:Cpsf7 UTSW 19 10535439 missense possibly damaging 0.89
R2004:Cpsf7 UTSW 19 10540709 missense probably damaging 1.00
R2417:Cpsf7 UTSW 19 10525968 start gained probably benign
R4374:Cpsf7 UTSW 19 10539637 missense probably damaging 1.00
R5788:Cpsf7 UTSW 19 10540718 missense possibly damaging 0.88
R5801:Cpsf7 UTSW 19 10539632 missense probably benign 0.02
R6823:Cpsf7 UTSW 19 10532884 nonsense probably null
R7371:Cpsf7 UTSW 19 10531839 missense probably benign 0.00
R7602:Cpsf7 UTSW 19 10535373 missense probably damaging 0.99
R8185:Cpsf7 UTSW 19 10536860 nonsense probably null
Z1177:Cpsf7 UTSW 19 10535518 missense probably null 0.83
Predicted Primers PCR Primer
(F):5'- TGGGCAGTAACATTAGCTCTG -3'
(R):5'- TGTAAGTATCTGGTGGAGGCCC -3'

Sequencing Primer
(F):5'- GCAGTAACATTAGCTCTGTTTGC -3'
(R):5'- AGGCCCCACTGTAGCATTTG -3'
Posted On2014-10-16