Incidental Mutation 'R2286:Cpsf7'
ID 243318
Institutional Source Beutler Lab
Gene Symbol Cpsf7
Ensembl Gene ENSMUSG00000034820
Gene Name cleavage and polyadenylation specific factor 7
Synonyms 5730453I16Rik, C330017N18Rik
MMRRC Submission 040285-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2286 (G1)
Quality Score 204
Status Not validated
Chromosome 19
Chromosomal Location 10502630-10525017 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10512660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 248 (L248P)
Ref Sequence ENSEMBL: ENSMUSP00000038958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038379] [ENSMUST00000123788] [ENSMUST00000145210]
AlphaFold Q8BTV2
Predicted Effect probably damaging
Transcript: ENSMUST00000038379
AA Change: L248P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038958
Gene: ENSMUSG00000034820
AA Change: L248P

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
RRM 83 158 7.31e-8 SMART
low complexity region 188 202 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 265 291 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 405 439 N/A INTRINSIC
low complexity region 454 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123788
SMART Domains Protein: ENSMUSP00000119596
Gene: ENSMUSG00000024667

DomainStartEndE-ValueType
Pfam:Transmemb_17 15 123 9.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145210
SMART Domains Protein: ENSMUSP00000123397
Gene: ENSMUSG00000024667

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 69 2.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,195,616 (GRCm39) R308H probably damaging Het
Alox5ap G A 5: 149,222,240 (GRCm39) probably null Het
Ap2s1 T C 7: 16,482,901 (GRCm39) V131A possibly damaging Het
Cdr2l GAA GA 11: 115,283,626 (GRCm39) probably null Het
Dtd1 T C 2: 144,477,786 (GRCm39) probably null Het
Eci1 A G 17: 24,652,203 (GRCm39) D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,151,791 (GRCm39) probably benign Het
Luc7l A G 17: 26,499,020 (GRCm39) probably benign Het
Med13 A C 11: 86,210,515 (GRCm39) D542E probably benign Het
Myo6 T C 9: 80,173,494 (GRCm39) S545P possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Or4k37 A G 2: 111,159,252 (GRCm39) I163V probably benign Het
Rsad2 T A 12: 26,500,675 (GRCm39) N204I probably benign Het
Setd5 T G 6: 113,096,571 (GRCm39) N592K possibly damaging Het
Sgip1 G T 4: 102,724,844 (GRCm39) S59I possibly damaging Het
Slc39a5 A G 10: 128,231,929 (GRCm39) V532A probably benign Het
Smarcc2 G A 10: 128,299,612 (GRCm39) M123I possibly damaging Het
Tdrd1 A G 19: 56,827,551 (GRCm39) T185A probably benign Het
Tnn T C 1: 159,938,079 (GRCm39) E1146G possibly damaging Het
Unc13a T C 8: 72,083,203 (GRCm39) K1618E probably damaging Het
Vmn2r120 A G 17: 57,815,958 (GRCm39) L799P probably damaging Het
Vps26c C T 16: 94,313,112 (GRCm39) E60K possibly damaging Het
Other mutations in Cpsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cpsf7 APN 19 10,517,151 (GRCm39) missense probably damaging 0.98
IGL00870:Cpsf7 APN 19 10,517,014 (GRCm39) splice site probably null
IGL01883:Cpsf7 APN 19 10,503,387 (GRCm39) missense possibly damaging 0.69
IGL02406:Cpsf7 APN 19 10,509,352 (GRCm39) missense probably damaging 0.96
IGL02491:Cpsf7 APN 19 10,517,001 (GRCm39) missense possibly damaging 0.92
IGL02990:Cpsf7 APN 19 10,509,159 (GRCm39) missense probably benign
R0003:Cpsf7 UTSW 19 10,516,993 (GRCm39) missense possibly damaging 0.88
R0540:Cpsf7 UTSW 19 10,510,682 (GRCm39) nonsense probably null
R0633:Cpsf7 UTSW 19 10,509,146 (GRCm39) missense probably benign 0.09
R0662:Cpsf7 UTSW 19 10,503,372 (GRCm39) start codon destroyed probably null 0.77
R1309:Cpsf7 UTSW 19 10,510,831 (GRCm39) critical splice donor site probably null
R1817:Cpsf7 UTSW 19 10,512,803 (GRCm39) missense possibly damaging 0.89
R2004:Cpsf7 UTSW 19 10,518,073 (GRCm39) missense probably damaging 1.00
R2417:Cpsf7 UTSW 19 10,503,332 (GRCm39) start gained probably benign
R4374:Cpsf7 UTSW 19 10,517,001 (GRCm39) missense probably damaging 1.00
R5788:Cpsf7 UTSW 19 10,518,082 (GRCm39) missense possibly damaging 0.88
R5801:Cpsf7 UTSW 19 10,516,996 (GRCm39) missense probably benign 0.02
R6823:Cpsf7 UTSW 19 10,510,248 (GRCm39) nonsense probably null
R7371:Cpsf7 UTSW 19 10,509,203 (GRCm39) missense probably benign 0.00
R7602:Cpsf7 UTSW 19 10,512,737 (GRCm39) missense probably damaging 0.99
R8185:Cpsf7 UTSW 19 10,514,224 (GRCm39) nonsense probably null
R8935:Cpsf7 UTSW 19 10,509,345 (GRCm39) nonsense probably null
R9450:Cpsf7 UTSW 19 10,518,213 (GRCm39) critical splice donor site probably null
Z1177:Cpsf7 UTSW 19 10,512,882 (GRCm39) missense probably null 0.83
Predicted Primers PCR Primer
(F):5'- TGGGCAGTAACATTAGCTCTG -3'
(R):5'- TGTAAGTATCTGGTGGAGGCCC -3'

Sequencing Primer
(F):5'- GCAGTAACATTAGCTCTGTTTGC -3'
(R):5'- AGGCCCCACTGTAGCATTTG -3'
Posted On 2014-10-16