Incidental Mutation 'R2256:Vmn2r59'
ID243371
Institutional Source Beutler Lab
Gene Symbol Vmn2r59
Ensembl Gene ENSMUSG00000092032
Gene Namevomeronasal 2, receptor 59
SynonymsEG628444
MMRRC Submission 040256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2256 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42011792-42058981 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 42012245 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 715 (C715*)
Ref Sequence ENSEMBL: ENSMUSP00000131856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168489]
Predicted Effect probably null
Transcript: ENSMUST00000168489
AA Change: C715*
SMART Domains Protein: ENSMUSP00000131856
Gene: ENSMUSG00000092032
AA Change: C715*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-44 PFAM
Pfam:NCD3G 514 567 4.3e-23 PFAM
Pfam:7tm_3 600 835 5.4e-53 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (97/99)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
6720489N17Rik A T 13: 62,607,396 I36N probably benign Het
Abcb4 T C 5: 8,958,431 S1200P probably damaging Het
Acadsb A G 7: 131,443,653 Y438C probably benign Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Actr3b A G 5: 25,822,405 T113A possibly damaging Het
Adgrv1 T C 13: 81,506,140 D2204G probably benign Het
Ago1 A G 4: 126,441,911 V669A possibly damaging Het
Ang5 T A 14: 43,962,521 L14Q probably null Het
Aoc1 T C 6: 48,906,440 Y417H possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atf2 A T 2: 73,845,511 probably null Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Bend5 A C 4: 111,431,010 probably benign Het
Camkk2 T C 5: 122,746,335 D341G probably damaging Het
Cast T A 13: 74,739,905 I208L probably damaging Het
Ccdc141 A T 2: 77,132,262 W113R probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cel A G 2: 28,561,192 F51S probably damaging Het
Cenpc1 A G 5: 86,016,203 L853S probably damaging Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Cntnap5c T A 17: 58,330,315 N1062K probably benign Het
Col3a1 A G 1: 45,321,632 D74G unknown Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cox6a1 C T 5: 115,348,848 E35K possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Ddx46 A G 13: 55,647,708 K177E possibly damaging Het
Dmbt1 T C 7: 131,090,494 F823L probably benign Het
Drc7 A T 8: 95,075,009 H666L probably benign Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam71e2 T A 7: 4,771,021 M31L probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fhdc1 T C 3: 84,446,046 E624G probably benign Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Fsip2 T A 2: 82,962,751 D417E probably benign Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Gtf2b A G 3: 142,781,424 D207G probably benign Het
Has3 C A 8: 106,874,256 L117I probably damaging Het
Jmjd1c T A 10: 67,225,294 I1142N probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mast4 A T 13: 102,735,751 C2178S possibly damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mphosph9 C T 5: 124,283,659 V740I probably benign Het
Mut A T 17: 40,956,319 I595F probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nlrc4 A G 17: 74,445,630 I586T probably damaging Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr1000 T A 2: 85,608,463 Y149F possibly damaging Het
Olfr1254 T C 2: 89,788,470 H294R probably benign Het
Olfr1290 T C 2: 111,489,978 Y60C probably damaging Het
Olfr474 A T 7: 107,955,037 Y132F probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Orai2 C T 5: 136,161,600 V52I probably damaging Het
Osbpl5 A G 7: 143,709,094 C186R probably damaging Het
Osbpl6 A G 2: 76,584,474 E403G probably damaging Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Parm1 C T 5: 91,594,121 T116I possibly damaging Het
Pde4dip T A 3: 97,718,184 Q1366L probably damaging Het
Phgdh T C 3: 98,328,291 K108E probably benign Het
Pold1 T C 7: 44,533,799 probably null Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Sdk2 T C 11: 113,830,794 N1332S probably benign Het
Sema6d A G 2: 124,664,150 D626G probably damaging Het
Skiv2l2 A T 13: 112,876,512 M890K probably damaging Het
Slc18b1 A G 10: 23,810,922 N212S probably benign Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Sntg2 C T 12: 30,236,688 W302* probably null Het
Spata22 T A 11: 73,340,475 M185K possibly damaging Het
Stk35 T A 2: 129,810,507 Y309* probably null Het
Taar8c A G 10: 24,101,071 V281A probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmtc4 A T 14: 122,941,408 I449N probably benign Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Tmub1 G A 5: 24,447,177 probably benign Het
Tshz2 A G 2: 169,886,477 T529A probably damaging Het
Ugdh A T 5: 65,417,115 probably benign Het
Usp25 A G 16: 77,113,794 K913E probably benign Het
Vgf A G 5: 137,031,547 probably benign Het
Vmn2r19 T A 6: 123,329,886 F451Y probably benign Het
Vps9d1 C A 8: 123,245,121 A582S probably benign Het
Xbp1 T G 11: 5,524,841 H247Q probably damaging Het
Zfp319 A T 8: 95,328,501 M358K possibly damaging Het
Zfp438 A T 18: 5,213,508 N483K probably damaging Het
Zfp518b T C 5: 38,671,636 N1009D possibly damaging Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Zgrf1 T A 3: 127,561,997 S291T probably benign Het
Other mutations in Vmn2r59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r59 APN 7 42012064 missense possibly damaging 0.91
IGL01432:Vmn2r59 APN 7 42012559 missense possibly damaging 0.82
IGL02119:Vmn2r59 APN 7 42046169 missense probably benign 0.36
IGL02216:Vmn2r59 APN 7 42012393 missense probably damaging 1.00
IGL02327:Vmn2r59 APN 7 42012231 missense probably benign
IGL03346:Vmn2r59 APN 7 42043829 missense probably benign 0.00
IGL03411:Vmn2r59 APN 7 42058916 missense probably benign 0.43
IGL03412:Vmn2r59 APN 7 42012438 missense probably benign
PIT4366001:Vmn2r59 UTSW 7 42045781 missense possibly damaging 0.91
R0068:Vmn2r59 UTSW 7 42046301 missense probably damaging 0.99
R0094:Vmn2r59 UTSW 7 42012298 missense probably benign 0.07
R0179:Vmn2r59 UTSW 7 42047008 nonsense probably null
R0370:Vmn2r59 UTSW 7 42012726 missense probably benign 0.23
R0412:Vmn2r59 UTSW 7 42046492 splice site probably benign
R0465:Vmn2r59 UTSW 7 42046908 missense probably benign
R0487:Vmn2r59 UTSW 7 42047104 nonsense probably null
R0576:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R0632:Vmn2r59 UTSW 7 42058884 missense probably damaging 1.00
R1356:Vmn2r59 UTSW 7 42011794 makesense probably null
R1387:Vmn2r59 UTSW 7 42046097 missense probably damaging 1.00
R1388:Vmn2r59 UTSW 7 42045709 missense probably benign 0.01
R1435:Vmn2r59 UTSW 7 42046205 missense possibly damaging 0.50
R1750:Vmn2r59 UTSW 7 42045827 missense possibly damaging 0.50
R2020:Vmn2r59 UTSW 7 42043779 missense probably damaging 1.00
R2249:Vmn2r59 UTSW 7 42058902 missense probably benign 0.00
R2257:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2441:Vmn2r59 UTSW 7 42046146 missense probably benign 0.00
R2511:Vmn2r59 UTSW 7 42043766 missense probably damaging 1.00
R2860:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R2861:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R3690:Vmn2r59 UTSW 7 42011946 missense possibly damaging 0.77
R3912:Vmn2r59 UTSW 7 42046320 missense probably benign 0.00
R4167:Vmn2r59 UTSW 7 42021308 intron probably benign
R4357:Vmn2r59 UTSW 7 42012220 missense probably damaging 1.00
R4445:Vmn2r59 UTSW 7 42042450 missense probably damaging 1.00
R4542:Vmn2r59 UTSW 7 42046073 missense possibly damaging 0.93
R4587:Vmn2r59 UTSW 7 42046224 missense probably benign 0.00
R4616:Vmn2r59 UTSW 7 42012438 missense probably benign
R4653:Vmn2r59 UTSW 7 42043804 missense probably benign 0.19
R4703:Vmn2r59 UTSW 7 42012262 missense probably benign 0.01
R4895:Vmn2r59 UTSW 7 42045794 missense probably damaging 0.98
R4910:Vmn2r59 UTSW 7 42043653 missense probably benign
R5045:Vmn2r59 UTSW 7 42046072 missense possibly damaging 0.93
R5105:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R5153:Vmn2r59 UTSW 7 42042410 critical splice donor site probably null
R5566:Vmn2r59 UTSW 7 42046823 missense possibly damaging 0.92
R5586:Vmn2r59 UTSW 7 42045681 missense probably benign 0.12
R5606:Vmn2r59 UTSW 7 42045894 missense probably benign 0.27
R5616:Vmn2r59 UTSW 7 42058767 splice site probably null
R5625:Vmn2r59 UTSW 7 42046460 missense probably benign 0.03
R5696:Vmn2r59 UTSW 7 42046044 missense probably benign 0.00
R5982:Vmn2r59 UTSW 7 42046067 missense probably benign 0.00
R6106:Vmn2r59 UTSW 7 42012325 nonsense probably null
R6196:Vmn2r59 UTSW 7 42012255 missense probably benign 0.36
R6228:Vmn2r59 UTSW 7 42042411 critical splice donor site probably null
R6590:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6625:Vmn2r59 UTSW 7 42043753 missense probably benign 0.02
R6690:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6768:Vmn2r59 UTSW 7 42011968 missense probably benign 0.17
R6830:Vmn2r59 UTSW 7 42043747 missense probably benign 0.10
R6859:Vmn2r59 UTSW 7 42043853 missense probably damaging 1.00
R7034:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7036:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7145:Vmn2r59 UTSW 7 42045764 missense probably damaging 1.00
R7556:Vmn2r59 UTSW 7 42045809 missense probably damaging 1.00
R7733:Vmn2r59 UTSW 7 42012019 missense probably benign 0.17
R7770:Vmn2r59 UTSW 7 42058912 missense probably damaging 1.00
R7812:Vmn2r59 UTSW 7 42045772 nonsense probably null
X0025:Vmn2r59 UTSW 7 42045941 missense probably damaging 1.00
Z1088:Vmn2r59 UTSW 7 42012414 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGAAACTTGGCTTCATTGAAGG -3'
(R):5'- CACAATCACCTGCATCTTGC -3'

Sequencing Primer
(F):5'- CTTCATTGAAGGTGTCAGGAAGATTC -3'
(R):5'- GCATCTTGCAGCAGACAGC -3'
Posted On2014-10-16