Incidental Mutation 'R2256:Arhgap32'
ID243391
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 040256-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2256 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32247497 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 186 (I186T)
Ref Sequence ENSEMBL: ENSMUSP00000138145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802] [ENSMUST00000183121]
Predicted Effect probably damaging
Transcript: ENSMUST00000168954
AA Change: I186T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: I186T

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174641
AA Change: I535T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: I535T

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174730
Predicted Effect probably damaging
Transcript: ENSMUST00000182802
AA Change: I186T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: I186T

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183121
SMART Domains Protein: ENSMUSP00000138584
Gene: ENSMUSG00000041444

DomainStartEndE-ValueType
Pfam:RhoGAP 37 92 5.9e-11 PFAM
Meta Mutation Damage Score 0.2644 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
6720489N17Rik A T 13: 62,607,396 I36N probably benign Het
Abcb4 T C 5: 8,958,431 S1200P probably damaging Het
Acadsb A G 7: 131,443,653 Y438C probably benign Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Actr3b A G 5: 25,822,405 T113A possibly damaging Het
Adgrv1 T C 13: 81,506,140 D2204G probably benign Het
Ago1 A G 4: 126,441,911 V669A possibly damaging Het
Ang5 T A 14: 43,962,521 L14Q probably null Het
Aoc1 T C 6: 48,906,440 Y417H possibly damaging Het
Atf2 A T 2: 73,845,511 probably null Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Bend5 A C 4: 111,431,010 probably benign Het
Camkk2 T C 5: 122,746,335 D341G probably damaging Het
Cast T A 13: 74,739,905 I208L probably damaging Het
Ccdc141 A T 2: 77,132,262 W113R probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cel A G 2: 28,561,192 F51S probably damaging Het
Cenpc1 A G 5: 86,016,203 L853S probably damaging Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Cntnap5c T A 17: 58,330,315 N1062K probably benign Het
Col3a1 A G 1: 45,321,632 D74G unknown Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cox6a1 C T 5: 115,348,848 E35K possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Ddx46 A G 13: 55,647,708 K177E possibly damaging Het
Dmbt1 T C 7: 131,090,494 F823L probably benign Het
Drc7 A T 8: 95,075,009 H666L probably benign Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam71e2 T A 7: 4,771,021 M31L probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fhdc1 T C 3: 84,446,046 E624G probably benign Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Fsip2 T A 2: 82,962,751 D417E probably benign Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Gtf2b A G 3: 142,781,424 D207G probably benign Het
Has3 C A 8: 106,874,256 L117I probably damaging Het
Jmjd1c T A 10: 67,225,294 I1142N probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mast4 A T 13: 102,735,751 C2178S possibly damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mphosph9 C T 5: 124,283,659 V740I probably benign Het
Mut A T 17: 40,956,319 I595F probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nlrc4 A G 17: 74,445,630 I586T probably damaging Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr1000 T A 2: 85,608,463 Y149F possibly damaging Het
Olfr1254 T C 2: 89,788,470 H294R probably benign Het
Olfr1290 T C 2: 111,489,978 Y60C probably damaging Het
Olfr474 A T 7: 107,955,037 Y132F probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Orai2 C T 5: 136,161,600 V52I probably damaging Het
Osbpl5 A G 7: 143,709,094 C186R probably damaging Het
Osbpl6 A G 2: 76,584,474 E403G probably damaging Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Parm1 C T 5: 91,594,121 T116I possibly damaging Het
Pde4dip T A 3: 97,718,184 Q1366L probably damaging Het
Phgdh T C 3: 98,328,291 K108E probably benign Het
Pold1 T C 7: 44,533,799 probably null Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Sdk2 T C 11: 113,830,794 N1332S probably benign Het
Sema6d A G 2: 124,664,150 D626G probably damaging Het
Skiv2l2 A T 13: 112,876,512 M890K probably damaging Het
Slc18b1 A G 10: 23,810,922 N212S probably benign Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Sntg2 C T 12: 30,236,688 W302* probably null Het
Spata22 T A 11: 73,340,475 M185K possibly damaging Het
Stk35 T A 2: 129,810,507 Y309* probably null Het
Taar8c A G 10: 24,101,071 V281A probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmtc4 A T 14: 122,941,408 I449N probably benign Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Tmub1 G A 5: 24,447,177 probably benign Het
Tshz2 A G 2: 169,886,477 T529A probably damaging Het
Ugdh A T 5: 65,417,115 probably benign Het
Usp25 A G 16: 77,113,794 K913E probably benign Het
Vgf A G 5: 137,031,547 probably benign Het
Vmn2r19 T A 6: 123,329,886 F451Y probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps9d1 C A 8: 123,245,121 A582S probably benign Het
Xbp1 T G 11: 5,524,841 H247Q probably damaging Het
Zfp319 A T 8: 95,328,501 M358K possibly damaging Het
Zfp438 A T 18: 5,213,508 N483K probably damaging Het
Zfp518b T C 5: 38,671,636 N1009D possibly damaging Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Zgrf1 T A 3: 127,561,997 S291T probably benign Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
R7391:Arhgap32 UTSW 9 32181939 missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32245924 missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32250722 missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32256967 missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32257145 missense probably benign
R7884:Arhgap32 UTSW 9 32260514 missense possibly damaging 0.87
R8087:Arhgap32 UTSW 9 32257028 missense probably benign 0.00
R8109:Arhgap32 UTSW 9 32181854 missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32247130 missense probably damaging 1.00
R8155:Arhgap32 UTSW 9 32181900 missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32256902 missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32260909 missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32255937 nonsense probably null
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32260680 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCCATCACAAATATGCATGCG -3'
(R):5'- TTCCTGGTGACAAGGAAAAGC -3'

Sequencing Primer
(F):5'- GCGAAAAACCTTGCCATTGTGTG -3'
(R):5'- AAGCCATCGGAGCCGTAC -3'
Posted On2014-10-16