Incidental Mutation 'R2256:Usp25'
ID243411
Institutional Source Beutler Lab
Gene Symbol Usp25
Ensembl Gene ENSMUSG00000022867
Gene Nameubiquitin specific peptidase 25
Synonyms
MMRRC Submission 040256-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2256 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location77013706-77116780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77113794 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 913 (K913E)
Ref Sequence ENSEMBL: ENSMUSP00000023580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023580]
PDB Structure
Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000023580
AA Change: K913E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: K913E

DomainStartEndE-ValueType
PDB:1VDL|A 1 67 2e-35 PDB
Blast:UBA 17 56 9e-16 BLAST
UIM 97 116 5.27e-3 SMART
Pfam:UIM 124 140 6.7e-3 PFAM
Pfam:UCH 168 655 9.3e-55 PFAM
Pfam:UCH_1 169 632 3.1e-14 PFAM
coiled coil region 685 714 N/A INTRINSIC
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
6720489N17Rik A T 13: 62,607,396 I36N probably benign Het
Abcb4 T C 5: 8,958,431 S1200P probably damaging Het
Acadsb A G 7: 131,443,653 Y438C probably benign Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Actr3b A G 5: 25,822,405 T113A possibly damaging Het
Adgrv1 T C 13: 81,506,140 D2204G probably benign Het
Ago1 A G 4: 126,441,911 V669A possibly damaging Het
Ang5 T A 14: 43,962,521 L14Q probably null Het
Aoc1 T C 6: 48,906,440 Y417H possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atf2 A T 2: 73,845,511 probably null Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Bend5 A C 4: 111,431,010 probably benign Het
Camkk2 T C 5: 122,746,335 D341G probably damaging Het
Cast T A 13: 74,739,905 I208L probably damaging Het
Ccdc141 A T 2: 77,132,262 W113R probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cel A G 2: 28,561,192 F51S probably damaging Het
Cenpc1 A G 5: 86,016,203 L853S probably damaging Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Cntnap5c T A 17: 58,330,315 N1062K probably benign Het
Col3a1 A G 1: 45,321,632 D74G unknown Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cox6a1 C T 5: 115,348,848 E35K possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Ddx46 A G 13: 55,647,708 K177E possibly damaging Het
Dmbt1 T C 7: 131,090,494 F823L probably benign Het
Drc7 A T 8: 95,075,009 H666L probably benign Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam71e2 T A 7: 4,771,021 M31L probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fhdc1 T C 3: 84,446,046 E624G probably benign Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Fsip2 T A 2: 82,962,751 D417E probably benign Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Gtf2b A G 3: 142,781,424 D207G probably benign Het
Has3 C A 8: 106,874,256 L117I probably damaging Het
Jmjd1c T A 10: 67,225,294 I1142N probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mast4 A T 13: 102,735,751 C2178S possibly damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mphosph9 C T 5: 124,283,659 V740I probably benign Het
Mut A T 17: 40,956,319 I595F probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nlrc4 A G 17: 74,445,630 I586T probably damaging Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr1000 T A 2: 85,608,463 Y149F possibly damaging Het
Olfr1254 T C 2: 89,788,470 H294R probably benign Het
Olfr1290 T C 2: 111,489,978 Y60C probably damaging Het
Olfr474 A T 7: 107,955,037 Y132F probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Orai2 C T 5: 136,161,600 V52I probably damaging Het
Osbpl5 A G 7: 143,709,094 C186R probably damaging Het
Osbpl6 A G 2: 76,584,474 E403G probably damaging Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Parm1 C T 5: 91,594,121 T116I possibly damaging Het
Pde4dip T A 3: 97,718,184 Q1366L probably damaging Het
Phgdh T C 3: 98,328,291 K108E probably benign Het
Pold1 T C 7: 44,533,799 probably null Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Sdk2 T C 11: 113,830,794 N1332S probably benign Het
Sema6d A G 2: 124,664,150 D626G probably damaging Het
Skiv2l2 A T 13: 112,876,512 M890K probably damaging Het
Slc18b1 A G 10: 23,810,922 N212S probably benign Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Sntg2 C T 12: 30,236,688 W302* probably null Het
Spata22 T A 11: 73,340,475 M185K possibly damaging Het
Stk35 T A 2: 129,810,507 Y309* probably null Het
Taar8c A G 10: 24,101,071 V281A probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmtc4 A T 14: 122,941,408 I449N probably benign Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Tmub1 G A 5: 24,447,177 probably benign Het
Tshz2 A G 2: 169,886,477 T529A probably damaging Het
Ugdh A T 5: 65,417,115 probably benign Het
Vgf A G 5: 137,031,547 probably benign Het
Vmn2r19 T A 6: 123,329,886 F451Y probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps9d1 C A 8: 123,245,121 A582S probably benign Het
Xbp1 T G 11: 5,524,841 H247Q probably damaging Het
Zfp319 A T 8: 95,328,501 M358K possibly damaging Het
Zfp438 A T 18: 5,213,508 N483K probably damaging Het
Zfp518b T C 5: 38,671,636 N1009D possibly damaging Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Zgrf1 T A 3: 127,561,997 S291T probably benign Het
Other mutations in Usp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Usp25 APN 16 77062405 missense probably damaging 1.00
IGL01359:Usp25 APN 16 77059253 missense probably damaging 1.00
IGL01380:Usp25 APN 16 77093678 missense probably benign 0.06
IGL01614:Usp25 APN 16 77077117 missense probably damaging 1.00
IGL02065:Usp25 APN 16 77083782 missense probably benign 0.06
IGL02271:Usp25 APN 16 77115447 missense probably damaging 1.00
IGL03184:Usp25 APN 16 77081653 missense probably damaging 1.00
IGL03046:Usp25 UTSW 16 77074866 missense probably damaging 1.00
R0433:Usp25 UTSW 16 77109217 missense probably benign 0.02
R0741:Usp25 UTSW 16 77071708 missense possibly damaging 0.80
R0944:Usp25 UTSW 16 77081447 splice site probably benign
R1324:Usp25 UTSW 16 77080387 missense probably damaging 0.98
R1341:Usp25 UTSW 16 77115443 missense probably benign
R1373:Usp25 UTSW 16 77062385 splice site probably benign
R1641:Usp25 UTSW 16 77071671 missense possibly damaging 0.89
R1777:Usp25 UTSW 16 77081554 missense probably damaging 1.00
R1813:Usp25 UTSW 16 77114950 missense probably benign 0.00
R1960:Usp25 UTSW 16 77076371 missense probably damaging 1.00
R2271:Usp25 UTSW 16 77076429 missense probably damaging 0.97
R4404:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4408:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4502:Usp25 UTSW 16 77115396 missense probably damaging 1.00
R4604:Usp25 UTSW 16 77115415 missense probably damaging 1.00
R4612:Usp25 UTSW 16 77033945 missense possibly damaging 0.92
R4744:Usp25 UTSW 16 77114989 missense probably damaging 1.00
R4867:Usp25 UTSW 16 77050467 missense probably damaging 1.00
R4932:Usp25 UTSW 16 77033982 critical splice donor site probably null
R5087:Usp25 UTSW 16 77077119 missense probably benign 0.00
R5165:Usp25 UTSW 16 77076405 missense possibly damaging 0.85
R5184:Usp25 UTSW 16 77109227 missense probably benign 0.00
R5307:Usp25 UTSW 16 77093706 missense probably benign
R5331:Usp25 UTSW 16 77050558 missense probably damaging 1.00
R5355:Usp25 UTSW 16 77050454 missense probably damaging 1.00
R5479:Usp25 UTSW 16 77107913 missense possibly damaging 0.51
R5619:Usp25 UTSW 16 77033945 missense probably benign 0.22
R5646:Usp25 UTSW 16 77050472 missense probably benign 0.34
R5946:Usp25 UTSW 16 77115054 nonsense probably null
R6013:Usp25 UTSW 16 77077021 missense probably benign 0.00
R6418:Usp25 UTSW 16 77062442 missense probably damaging 1.00
R6653:Usp25 UTSW 16 77059288 missense probably benign 0.29
R6709:Usp25 UTSW 16 77083932 missense probably benign
R6987:Usp25 UTSW 16 77077180 missense probably damaging 1.00
R7418:Usp25 UTSW 16 77113842 nonsense probably null
R7500:Usp25 UTSW 16 77077201 missense probably damaging 1.00
R7886:Usp25 UTSW 16 77113771 missense probably damaging 0.99
R7969:Usp25 UTSW 16 77113771 missense probably damaging 0.99
R8005:Usp25 UTSW 16 77077068 missense probably benign
R8046:Usp25 UTSW 16 77109175 missense probably damaging 1.00
R8069:Usp25 UTSW 16 77069055 missense possibly damaging 0.58
R8140:Usp25 UTSW 16 77071681 nonsense probably null
X0065:Usp25 UTSW 16 77081556 missense probably damaging 1.00
Z1176:Usp25 UTSW 16 77071791 missense probably damaging 0.98
Z1176:Usp25 UTSW 16 77071792 missense possibly damaging 0.93
Z1176:Usp25 UTSW 16 77081521 missense probably damaging 1.00
Z1176:Usp25 UTSW 16 77083913 missense probably benign
Z1176:Usp25 UTSW 16 77113830 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGCCGAACTTATTGTGTTG -3'
(R):5'- CTACAAGGAACGCAGTGTTGC -3'

Sequencing Primer
(F):5'- ACTGTGTGTTTATTTCAAG -3'
(R):5'- GTGTTGCATTAAATCAAGGAAAGTG -3'
Posted On2014-10-16