Incidental Mutation 'R2257:Mical3'
ID243448
Institutional Source Beutler Lab
Gene Symbol Mical3
Ensembl Gene ENSMUSG00000051586
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 3
SynonymsMICAL-3, C130040D16Rik
MMRRC Submission 040257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R2257 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120931707-121130999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121033735 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 429 (S429T)
Ref Sequence ENSEMBL: ENSMUSP00000146544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077159] [ENSMUST00000203254] [ENSMUST00000204248] [ENSMUST00000207889]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077159
AA Change: S429T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076402
Gene: ENSMUSG00000051586
AA Change: S429T

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 1.4e-7 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 4.44e-17 SMART
low complexity region 625 635 N/A INTRINSIC
LIM 763 815 2.78e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203254
AA Change: S429T

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145254
Gene: ENSMUSG00000051586
AA Change: S429T

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 8.6e-6 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 2.2e-19 SMART
low complexity region 640 655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204248
AA Change: S429T

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145439
Gene: ENSMUSG00000051586
AA Change: S429T

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 9.1e-6 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 2.2e-19 SMART
low complexity region 625 635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204994
Predicted Effect possibly damaging
Transcript: ENSMUST00000207889
AA Change: S429T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1628 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Kif4 A T X: 100,726,131 N1126Y probably benign Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mrps35 A G 6: 147,070,627 E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nob1 A G 8: 107,417,097 probably benign Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmprss7 A T 16: 45,686,333 M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Mical3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Mical3 APN 6 120961624 missense possibly damaging 0.73
IGL00718:Mical3 APN 6 121040449 missense probably damaging 0.98
IGL00940:Mical3 APN 6 121022410 missense possibly damaging 0.55
IGL00973:Mical3 APN 6 120934924 splice site probably benign
IGL01503:Mical3 APN 6 120958576 missense probably benign 0.09
IGL01991:Mical3 APN 6 120935211 missense probably damaging 0.98
IGL02794:Mical3 APN 6 121007309 missense probably damaging 0.99
IGL02996:Mical3 APN 6 120958558 missense probably damaging 1.00
IGL03105:Mical3 APN 6 121042238 missense probably benign 0.01
IGL03109:Mical3 APN 6 121009124 missense probably damaging 1.00
IGL03236:Mical3 APN 6 120969384 missense probably benign 0.00
P0028:Mical3 UTSW 6 121024689 missense probably benign 0.33
R0244:Mical3 UTSW 6 120957722 missense probably benign 0.00
R0494:Mical3 UTSW 6 120959201 missense possibly damaging 0.94
R0586:Mical3 UTSW 6 121029641 unclassified probably benign
R1029:Mical3 UTSW 6 120934678 missense probably benign 0.02
R1263:Mical3 UTSW 6 120952469 missense probably damaging 0.99
R1507:Mical3 UTSW 6 121042238 missense probably benign 0.36
R1527:Mical3 UTSW 6 121024779 missense probably damaging 0.99
R1623:Mical3 UTSW 6 121024807 missense probably damaging 0.99
R1680:Mical3 UTSW 6 120959643 missense probably benign 0.09
R1697:Mical3 UTSW 6 121007408 missense possibly damaging 0.84
R1817:Mical3 UTSW 6 121042235 missense probably benign 0.06
R1875:Mical3 UTSW 6 121042064 missense probably damaging 1.00
R1961:Mical3 UTSW 6 120982607 missense possibly damaging 0.94
R2004:Mical3 UTSW 6 120951322 missense probably damaging 1.00
R2093:Mical3 UTSW 6 121040386 missense probably damaging 1.00
R2141:Mical3 UTSW 6 121031134 splice site probably null
R2142:Mical3 UTSW 6 121031134 splice site probably null
R2404:Mical3 UTSW 6 120959828 missense probably benign 0.01
R2419:Mical3 UTSW 6 120959923 missense probably benign
R2509:Mical3 UTSW 6 121034157 missense probably damaging 1.00
R3784:Mical3 UTSW 6 121021337 missense probably benign 0.00
R4342:Mical3 UTSW 6 120934838 nonsense probably null
R4343:Mical3 UTSW 6 120934838 nonsense probably null
R4579:Mical3 UTSW 6 120958699 missense probably benign
R4603:Mical3 UTSW 6 120934838 nonsense probably null
R4605:Mical3 UTSW 6 121034080 nonsense probably null
R4610:Mical3 UTSW 6 120934838 nonsense probably null
R4611:Mical3 UTSW 6 120934838 nonsense probably null
R4623:Mical3 UTSW 6 120961625 nonsense probably null
R4669:Mical3 UTSW 6 120957703 missense probably damaging 0.98
R4704:Mical3 UTSW 6 120958688 missense probably benign 0.00
R4722:Mical3 UTSW 6 121038525 missense probably benign 0.00
R4863:Mical3 UTSW 6 121033787 missense probably damaging 0.99
R4878:Mical3 UTSW 6 120969387 missense possibly damaging 0.51
R4885:Mical3 UTSW 6 120935253 missense probably damaging 1.00
R4907:Mical3 UTSW 6 121007298 missense probably benign 0.00
R5007:Mical3 UTSW 6 121038069 missense probably damaging 0.98
R5299:Mical3 UTSW 6 120959512 missense possibly damaging 0.71
R5303:Mical3 UTSW 6 120959980 missense probably benign
R5368:Mical3 UTSW 6 120959473 missense probably damaging 1.00
R5955:Mical3 UTSW 6 121033750 missense probably damaging 0.99
R5970:Mical3 UTSW 6 120958271 nonsense probably null
R6000:Mical3 UTSW 6 121021320 missense probably benign 0.06
R6101:Mical3 UTSW 6 121033710 missense probably damaging 1.00
R6195:Mical3 UTSW 6 121016835 intron probably benign
R6210:Mical3 UTSW 6 121040517 unclassified probably null
R6225:Mical3 UTSW 6 120958723 missense probably damaging 0.98
R6258:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6260:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6349:Mical3 UTSW 6 120959525 missense probably benign
R6352:Mical3 UTSW 6 120952473 missense probably damaging 0.97
R6480:Mical3 UTSW 6 121034275 missense possibly damaging 0.76
R6704:Mical3 UTSW 6 121009800 intron probably benign
R6783:Mical3 UTSW 6 120958825 missense possibly damaging 0.85
R6925:Mical3 UTSW 6 120959390 missense probably benign 0.05
R6960:Mical3 UTSW 6 120958543 missense probably damaging 1.00
R7170:Mical3 UTSW 6 120973733 intron probably null
R7344:Mical3 UTSW 6 121036544 nonsense probably null
R7414:Mical3 UTSW 6 121034113 missense probably damaging 1.00
R7455:Mical3 UTSW 6 120958744 missense probably damaging 1.00
R7649:Mical3 UTSW 6 120934948 missense probably damaging 1.00
R8236:Mical3 UTSW 6 121012543 missense
R8286:Mical3 UTSW 6 121021188 missense possibly damaging 0.68
R8316:Mical3 UTSW 6 120934983 missense probably damaging 1.00
U24488:Mical3 UTSW 6 121001496 missense possibly damaging 0.90
Z1177:Mical3 UTSW 6 120959728 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCTCACATGATTACTGGAAAGAATC -3'
(R):5'- TGGGAGTTGTACCAGCAAGG -3'

Sequencing Primer
(F):5'- TGGGCAGACCACCTTGAG -3'
(R):5'- TACCAGCAAGGAGAAAAGATCTTTG -3'
Posted On2014-10-16