Incidental Mutation 'R2257:Clasrp'
ID243452
Institutional Source Beutler Lab
Gene Symbol Clasrp
Ensembl Gene ENSMUSG00000061028
Gene NameCLK4-associating serine/arginine rich protein
SynonymsSrsf16, Sfrs16, SWAP2
MMRRC Submission 040257-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2257 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19581035-19604486 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 19586585 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086041] [ENSMUST00000207524] [ENSMUST00000207663] [ENSMUST00000207907] [ENSMUST00000208068]
Predicted Effect unknown
Transcript: ENSMUST00000086041
AA Change: S383P
SMART Domains Protein: ENSMUSP00000083205
Gene: ENSMUSG00000061028
AA Change: S383P

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
DRY_EERY 39 171 1.28e-64 SMART
low complexity region 172 212 N/A INTRINSIC
low complexity region 241 260 N/A INTRINSIC
low complexity region 263 283 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 339 368 N/A INTRINSIC
low complexity region 372 446 N/A INTRINSIC
low complexity region 453 476 N/A INTRINSIC
low complexity region 480 532 N/A INTRINSIC
coiled coil region 574 630 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207447
Predicted Effect probably benign
Transcript: ENSMUST00000207524
Predicted Effect probably benign
Transcript: ENSMUST00000207663
Predicted Effect unknown
Transcript: ENSMUST00000207907
AA Change: S383P
Predicted Effect unknown
Transcript: ENSMUST00000208068
AA Change: S383P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209059
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: The protein encoded by this gene contains serine/arginine (SR) dipeptide repeat domains, and is thought to be involved in the regulation of alternative splicing. This protein is thought to interact with, and be phosphorylated by, Clk4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Kif4 A T X: 100,726,131 N1126Y probably benign Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mical3 A T 6: 121,033,735 S429T possibly damaging Het
Mrps35 A G 6: 147,070,627 E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nob1 A G 8: 107,417,097 probably benign Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmprss7 A T 16: 45,686,333 M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Clasrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Clasrp APN 7 19603254 missense probably damaging 1.00
clarissa UTSW 7 19590248 missense possibly damaging 0.82
suet UTSW 7 19586468 utr 3 prime probably benign
R0518:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0519:Clasrp UTSW 7 19584164 utr 3 prime probably benign
R0521:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0626:Clasrp UTSW 7 19584493 utr 3 prime probably benign
R0826:Clasrp UTSW 7 19584301 utr 3 prime probably benign
R1918:Clasrp UTSW 7 19585263 nonsense probably null
R2044:Clasrp UTSW 7 19586715 utr 3 prime probably benign
R2256:Clasrp UTSW 7 19586585 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2940:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3408:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3691:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4168:Clasrp UTSW 7 19581154 unclassified probably benign
R4496:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4505:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4507:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4572:Clasrp UTSW 7 19584464 splice site probably null
R4753:Clasrp UTSW 7 19594940 missense probably damaging 1.00
R4871:Clasrp UTSW 7 19590248 missense possibly damaging 0.82
R4938:Clasrp UTSW 7 19584778 splice site probably null
R5538:Clasrp UTSW 7 19584782 utr 3 prime probably benign
R5582:Clasrp UTSW 7 19586856 missense probably damaging 0.97
R5615:Clasrp UTSW 7 19586447 utr 3 prime probably benign
R5794:Clasrp UTSW 7 19591109 missense probably damaging 0.99
R5944:Clasrp UTSW 7 19594506 missense probably damaging 1.00
R6102:Clasrp UTSW 7 19586468 utr 3 prime probably benign
R6171:Clasrp UTSW 7 19584822 splice site probably benign
R6485:Clasrp UTSW 7 19586369 utr 3 prime probably benign
R6600:Clasrp UTSW 7 19590282 nonsense probably null
R7383:Clasrp UTSW 7 19585273 missense unknown
R7719:Clasrp UTSW 7 19587844 missense probably damaging 0.99
R7750:Clasrp UTSW 7 19584591 makesense probably null
R7808:Clasrp UTSW 7 19588746 splice site probably null
R8192:Clasrp UTSW 7 19595462 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TAAGTCACAGACCTGCTCCTTC -3'
(R):5'- AATCTAGTTCCGAGTCCCGC -3'

Sequencing Primer
(F):5'- AGCGTGAGTAGCGGTGTCC -3'
(R):5'- CAGTTTTGGAGGCAGCGAC -3'
Posted On2014-10-16