Incidental Mutation 'R2257:Olfr676'
ID243460
Institutional Source Beutler Lab
Gene Symbol Olfr676
Ensembl Gene ENSMUSG00000073915
Gene Nameolfactory receptor 676
SynonymsMOR32-1, GA_x6K02T2PBJ9-7664016-7664969
MMRRC Submission 040257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2257 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105032698-105037750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105035819 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 207 (Y207C)
Ref Sequence ENSEMBL: ENSMUSP00000151474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098162] [ENSMUST00000219602]
Predicted Effect probably benign
Transcript: ENSMUST00000098162
AA Change: Y207C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095765
Gene: ENSMUSG00000073915
AA Change: Y207C

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 3e-113 PFAM
Pfam:7TM_GPCR_Srsx 45 316 4.5e-7 PFAM
Pfam:7tm_1 51 301 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219042
Predicted Effect probably benign
Transcript: ENSMUST00000219602
AA Change: Y207C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Kif4 A T X: 100,726,131 N1126Y probably benign Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mical3 A T 6: 121,033,735 S429T possibly damaging Het
Mrps35 A G 6: 147,070,627 E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nob1 A G 8: 107,417,097 probably benign Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmprss7 A T 16: 45,686,333 M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Olfr676
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr676 APN 7 105035390 missense probably benign
IGL02244:Olfr676 APN 7 105035945 missense probably damaging 1.00
IGL03493:Olfr676 APN 7 105035944 missense probably damaging 1.00
R1181:Olfr676 UTSW 7 105035814 missense probably damaging 1.00
R1223:Olfr676 UTSW 7 105035566 missense probably benign 0.01
R1460:Olfr676 UTSW 7 105035708 missense possibly damaging 0.80
R1768:Olfr676 UTSW 7 105035950 missense probably benign 0.00
R2256:Olfr676 UTSW 7 105035819 missense probably benign 0.00
R3846:Olfr676 UTSW 7 105035689 missense probably benign 0.40
R4486:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4488:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4489:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4598:Olfr676 UTSW 7 105036073 missense probably benign 0.19
R4599:Olfr676 UTSW 7 105036073 missense probably benign 0.00
R4701:Olfr676 UTSW 7 105035591 missense probably damaging 1.00
R4855:Olfr676 UTSW 7 105035651 missense probably damaging 0.99
R5083:Olfr676 UTSW 7 105035411 missense probably damaging 1.00
R5743:Olfr676 UTSW 7 105036156 unclassified probably null
R5798:Olfr676 UTSW 7 105036137 missense probably benign 0.00
R6279:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R6300:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R7400:Olfr676 UTSW 7 105035210 missense probably benign
R7672:Olfr676 UTSW 7 105035543 missense probably damaging 1.00
R7698:Olfr676 UTSW 7 105035907 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTCACCAACAGAATCATCGTTG -3'
(R):5'- GGGATGTTGTGACCAAAGCG -3'

Sequencing Primer
(F):5'- CCAACAGAATCATCGTTGTGATTGC -3'
(R):5'- CCAAAGCGGTGAGTAAGGAAG -3'
Posted On2014-10-16