Incidental Mutation 'R2257:Copb1'
ID243461
Institutional Source Beutler Lab
Gene Symbol Copb1
Ensembl Gene ENSMUSG00000030754
Gene Namecoatomer protein complex, subunit beta 1
SynonymsCopb1, 2610019B04Rik
MMRRC Submission 040257-MU
Accession Numbers

Genbank: NM_033370; MGI: 1917599

Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R2257 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location114215559-114254711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114253875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 29 (D29V)
Ref Sequence ENSEMBL: ENSMUSP00000033012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033012]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033012
AA Change: D29V

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033012
Gene: ENSMUSG00000030754
AA Change: D29V

DomainStartEndE-ValueType
Pfam:Adaptin_N 19 539 2.4e-124 PFAM
low complexity region 643 660 N/A INTRINSIC
Pfam:Coatamer_beta_C 667 807 3.6e-63 PFAM
Pfam:Coatomer_b_Cpla 813 944 3.1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211417
Meta Mutation Damage Score 0.3289 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein subunit of the coatomer complex associated with non-clathrin coated vesicles. The coatomer complex, also known as the coat protein complex 1, forms in the cytoplasm and is recruited to the Golgi by activated guanosine triphosphatases. Once at the Golgi membrane, the coatomer complex may assist in the movement of protein and lipid components back to the endoplasmic reticulum. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Kif4 A T X: 100,726,131 N1126Y probably benign Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mical3 A T 6: 121,033,735 S429T possibly damaging Het
Mrps35 A G 6: 147,070,627 E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nob1 A G 8: 107,417,097 probably benign Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmprss7 A T 16: 45,686,333 M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Copb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Copb1 APN 7 114226776 missense probably benign 0.00
IGL02458:Copb1 APN 7 114246785 missense probably benign 0.00
IGL02549:Copb1 APN 7 114246797 missense probably benign 0.00
IGL02639:Copb1 APN 7 114226595 splice site probably benign
robbers UTSW 7 114248976 missense probably damaging 1.00
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0023:Copb1 UTSW 7 114250094 missense probably benign 0.26
R0631:Copb1 UTSW 7 114233282 missense probably benign 0.12
R1996:Copb1 UTSW 7 114232203 missense probably benign 0.00
R2256:Copb1 UTSW 7 114253875 missense possibly damaging 0.89
R3853:Copb1 UTSW 7 114223316 missense probably damaging 1.00
R4679:Copb1 UTSW 7 114248976 missense probably damaging 1.00
R4686:Copb1 UTSW 7 114221736 missense possibly damaging 0.94
R5057:Copb1 UTSW 7 114226762 missense probably benign
R5140:Copb1 UTSW 7 114246800 missense probably benign 0.01
R5669:Copb1 UTSW 7 114237585 missense probably damaging 1.00
R5779:Copb1 UTSW 7 114219572 missense probably damaging 1.00
R6017:Copb1 UTSW 7 114236797 missense probably benign 0.07
R6114:Copb1 UTSW 7 114246801 missense probably benign 0.00
R6403:Copb1 UTSW 7 114238451 missense probably damaging 1.00
R6826:Copb1 UTSW 7 114226719 missense probably benign 0.00
R6905:Copb1 UTSW 7 114253890 missense probably benign 0.00
R7241:Copb1 UTSW 7 114237356 missense probably damaging 0.96
R7293:Copb1 UTSW 7 114219602 missense probably damaging 1.00
R7485:Copb1 UTSW 7 114245485 missense possibly damaging 0.94
R8103:Copb1 UTSW 7 114234967 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CTTACATCATCAGAGAAGTTGAAAGT -3'
(R):5'- ATTTGCGGAATTTGTCTCCCT -3'

Sequencing Primer
(F):5'- CTATTAGTGAGTTCCAGGCTGACC -3'
(R):5'- AGATTTTCCTGGCACCTTTC -3'
Posted On2014-10-16