Incidental Mutation 'R2257:Fat1'
ID 243465
Institutional Source Beutler Lab
Gene Symbol Fat1
Ensembl Gene ENSMUSG00000070047
Gene Name FAT atypical cadherin 1
Synonyms mFat1, Fath, 2310038E12Rik
MMRRC Submission 040257-MU
Accession Numbers

Genbank: NM_001081286

Essential gene? Essential (E-score: 1.000) question?
Stock # R2257 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 44935447-45052257 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44950371 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 53 (Y53C)
Ref Sequence ENSEMBL: ENSMUSP00000149194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098796] [ENSMUST00000189017] [ENSMUST00000191428] [ENSMUST00000215588]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098796
AA Change: Y53C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096394
Gene: ENSMUSG00000070047
AA Change: Y53C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189017
AA Change: Y53C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000191428
AA Change: Y53C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140596
Gene: ENSMUSG00000070047
AA Change: Y53C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215588
AA Change: Y53C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8155 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit holoprosencephaly, anophthalmia, kidney defects and perinatal lethality. Mice homozygous for a hypomorphic allele exhibit altered shoulder girdle and facial musculature, retinal defects, abnormal inner earpatterning and kidney defects. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Targeted, other(1) Gene trapped(55)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 (GRCm38) probably benign Het
4930567H17Rik A T X: 70,394,406 (GRCm38) W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 (GRCm38) probably benign Het
Abcc3 C T 11: 94,363,594 (GRCm38) V693M probably damaging Het
Acp7 A C 7: 28,614,413 (GRCm38) W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 (GRCm38) Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 (GRCm38) I186T probably damaging Het
Atg4a A G X: 140,990,235 (GRCm38) I91V probably benign Het
Atp7b T G 8: 21,998,266 (GRCm38) T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 (GRCm38) S242P probably damaging Het
Cass4 T C 2: 172,427,470 (GRCm38) F493L probably damaging Het
Cass4 C T 2: 172,432,558 (GRCm38) P753L probably damaging Het
Cdk14 T A 5: 4,888,924 (GRCm38) M433L probably benign Het
Cep162 C A 9: 87,206,914 (GRCm38) D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 (GRCm38) R184P possibly damaging Het
Clasrp A G 7: 19,586,585 (GRCm38) probably benign Het
Copb1 T A 7: 114,253,875 (GRCm38) D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 (GRCm38) probably null Het
Dhx36 C T 3: 62,477,643 (GRCm38) G683S probably damaging Het
Dnah10 T A 5: 124,761,237 (GRCm38) I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 (GRCm38) P322A probably benign Het
Eml4 A G 17: 83,477,760 (GRCm38) T785A probably damaging Het
Fam228a T C 12: 4,737,775 (GRCm38) probably benign Het
Fam83e A T 7: 45,728,770 (GRCm38) K406M possibly damaging Het
Fam83e A T 7: 45,728,769 (GRCm38) K406* probably null Het
Fam90a1a T A 8: 21,963,517 (GRCm38) L296Q possibly damaging Het
Fcrls T C 3: 87,259,621 (GRCm38) I22V probably damaging Het
Fryl T A 5: 73,072,844 (GRCm38) N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 (GRCm38) M453V possibly damaging Het
Grm8 A T 6: 27,760,225 (GRCm38) C369S probably damaging Het
Hdc G A 2: 126,616,080 (GRCm38) probably null Het
Hsf3 A T X: 96,320,322 (GRCm38) L191* probably null Het
Kif4 A T X: 100,726,131 (GRCm38) N1126Y probably benign Het
Lat2 T C 5: 134,602,627 (GRCm38) D191G probably damaging Het
Lipt2 C T 7: 100,159,394 (GRCm38) T38I probably benign Het
Lmo7 T C 14: 101,900,130 (GRCm38) L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 (GRCm38) probably benign Het
Magea2 A T X: 155,027,859 (GRCm38) L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 (GRCm38) L543P probably damaging Het
Mgat4a T C 1: 37,490,313 (GRCm38) N24D probably benign Het
Mical3 A T 6: 121,033,735 (GRCm38) S429T possibly damaging Het
Mrps35 A G 6: 147,070,627 (GRCm38) E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 (GRCm38) S586T probably benign Het
Myo1e G A 9: 70,378,373 (GRCm38) probably null Het
Nob1 A G 8: 107,417,097 (GRCm38) probably benign Het
Nom1 T A 5: 29,437,752 (GRCm38) V417D probably damaging Het
Nphs1 A T 7: 30,467,992 (GRCm38) I782F possibly damaging Het
Numa1 A G 7: 102,000,791 (GRCm38) E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 (GRCm38) Y207C probably benign Het
Olfr845 A G 9: 19,338,493 (GRCm38) E11G probably benign Het
Padi4 G A 4: 140,759,940 (GRCm38) T217I possibly damaging Het
Pias3 C T 3: 96,699,646 (GRCm38) T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 (GRCm38) probably benign Het
Prrc2a G A 17: 35,161,068 (GRCm38) P185L unknown Het
Prss57 C T 10: 79,787,370 (GRCm38) C81Y probably damaging Het
Psen1 C T 12: 83,714,820 (GRCm38) S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 (GRCm38) S468P possibly damaging Het
Sla2 G A 2: 156,875,942 (GRCm38) R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 (GRCm38) T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 (GRCm38) M555K probably benign Het
Thoc1 C A 18: 9,993,466 (GRCm38) D608E possibly damaging Het
Tmem121b A G 6: 120,492,071 (GRCm38) Y562H probably damaging Het
Tmem121b A T 6: 120,492,069 (GRCm38) Y562* probably null Het
Tmprss7 A T 16: 45,686,333 (GRCm38) M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 (GRCm38) G14V possibly damaging Het
Uap1 A T 1: 170,158,743 (GRCm38) probably benign Het
Ugdh A T 5: 65,417,115 (GRCm38) probably benign Het
Vmn2r59 A T 7: 42,012,245 (GRCm38) C715* probably null Het
Vps13a G A 19: 16,682,174 (GRCm38) T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 (GRCm38) I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 (GRCm38) Q349K possibly damaging Het
Other mutations in Fat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fat1 APN 8 45,024,602 (GRCm38) missense possibly damaging 0.93
IGL00157:Fat1 APN 8 44,951,670 (GRCm38) missense possibly damaging 0.96
IGL00481:Fat1 APN 8 45,050,940 (GRCm38) missense probably benign 0.18
IGL00983:Fat1 APN 8 45,033,390 (GRCm38) missense probably damaging 1.00
IGL01089:Fat1 APN 8 45,017,857 (GRCm38) missense probably damaging 1.00
IGL01135:Fat1 APN 8 45,024,840 (GRCm38) missense probably damaging 1.00
IGL01143:Fat1 APN 8 45,035,532 (GRCm38) missense possibly damaging 0.72
IGL01155:Fat1 APN 8 45,023,949 (GRCm38) missense probably damaging 1.00
IGL01376:Fat1 APN 8 45,026,841 (GRCm38) missense probably benign 0.00
IGL01411:Fat1 APN 8 45,026,800 (GRCm38) missense probably damaging 1.00
IGL01443:Fat1 APN 8 45,040,576 (GRCm38) missense probably damaging 1.00
IGL01453:Fat1 APN 8 45,051,270 (GRCm38) missense probably damaging 1.00
IGL01606:Fat1 APN 8 45,023,049 (GRCm38) missense probably benign 0.26
IGL01622:Fat1 APN 8 45,029,555 (GRCm38) missense possibly damaging 0.64
IGL01623:Fat1 APN 8 45,029,555 (GRCm38) missense possibly damaging 0.64
IGL01672:Fat1 APN 8 45,040,700 (GRCm38) missense probably benign 0.05
IGL01735:Fat1 APN 8 45,036,239 (GRCm38) missense probably benign 0.07
IGL01793:Fat1 APN 8 44,989,112 (GRCm38) missense probably benign
IGL01820:Fat1 APN 8 45,010,502 (GRCm38) missense probably damaging 1.00
IGL01969:Fat1 APN 8 44,952,599 (GRCm38) missense probably damaging 0.98
IGL02012:Fat1 APN 8 45,027,540 (GRCm38) missense possibly damaging 0.95
IGL02227:Fat1 APN 8 45,023,659 (GRCm38) missense probably damaging 1.00
IGL02256:Fat1 APN 8 44,950,332 (GRCm38) missense probably damaging 1.00
IGL02273:Fat1 APN 8 44,950,331 (GRCm38) missense probably damaging 1.00
IGL02317:Fat1 APN 8 45,025,818 (GRCm38) missense probably benign 0.33
IGL02324:Fat1 APN 8 45,040,556 (GRCm38) missense probably damaging 1.00
IGL02336:Fat1 APN 8 44,951,583 (GRCm38) missense probably benign 0.16
IGL02442:Fat1 APN 8 44,950,323 (GRCm38) missense probably benign 0.02
IGL02486:Fat1 APN 8 45,025,072 (GRCm38) missense probably benign 0.16
IGL02551:Fat1 APN 8 45,051,398 (GRCm38) missense probably damaging 1.00
IGL02617:Fat1 APN 8 45,035,591 (GRCm38) missense probably benign 0.31
IGL02698:Fat1 APN 8 45,023,164 (GRCm38) missense probably benign
IGL02885:Fat1 APN 8 44,989,167 (GRCm38) missense probably benign 0.01
IGL02904:Fat1 APN 8 45,040,682 (GRCm38) missense probably damaging 1.00
IGL02953:Fat1 APN 8 45,024,314 (GRCm38) missense probably damaging 1.00
IGL03108:Fat1 APN 8 45,023,614 (GRCm38) missense probably damaging 1.00
IGL03153:Fat1 APN 8 45,030,123 (GRCm38) missense possibly damaging 0.83
IGL03183:Fat1 APN 8 44,950,586 (GRCm38) missense probably damaging 0.99
IGL03327:Fat1 APN 8 44,950,468 (GRCm38) missense probably damaging 1.00
IGL03405:Fat1 APN 8 45,025,241 (GRCm38) missense probably damaging 1.00
Laggardly UTSW 8 45,044,464 (GRCm38) missense probably damaging 1.00
R2257_fat1_465 UTSW 8 44,950,371 (GRCm38) missense probably damaging 1.00
Shrinkage UTSW 8 45,018,037 (GRCm38) missense probably damaging 1.00
F5493:Fat1 UTSW 8 45,025,480 (GRCm38) missense probably damaging 0.99
G1citation:Fat1 UTSW 8 45,026,404 (GRCm38) missense probably damaging 1.00
I2289:Fat1 UTSW 8 45,024,996 (GRCm38) missense probably benign 0.01
IGL02837:Fat1 UTSW 8 45,017,434 (GRCm38) missense probably benign 0.00
PIT4283001:Fat1 UTSW 8 45,037,207 (GRCm38) missense probably damaging 1.00
PIT4283001:Fat1 UTSW 8 45,029,540 (GRCm38) missense probably damaging 1.00
PIT4576001:Fat1 UTSW 8 45,024,645 (GRCm38) missense probably damaging 1.00
R0040:Fat1 UTSW 8 45,026,404 (GRCm38) missense probably damaging 1.00
R0040:Fat1 UTSW 8 45,026,404 (GRCm38) missense probably damaging 1.00
R0078:Fat1 UTSW 8 44,953,299 (GRCm38) missense probably damaging 1.00
R0197:Fat1 UTSW 8 45,026,553 (GRCm38) missense probably benign 0.00
R0328:Fat1 UTSW 8 45,023,790 (GRCm38) missense probably benign 0.35
R0367:Fat1 UTSW 8 45,024,313 (GRCm38) missense probably damaging 1.00
R0371:Fat1 UTSW 8 44,951,892 (GRCm38) missense probably damaging 1.00
R0380:Fat1 UTSW 8 45,010,123 (GRCm38) missense probably damaging 0.97
R0389:Fat1 UTSW 8 44,950,348 (GRCm38) missense probably benign 0.00
R0433:Fat1 UTSW 8 45,024,649 (GRCm38) missense possibly damaging 0.51
R0456:Fat1 UTSW 8 45,029,534 (GRCm38) missense probably damaging 1.00
R0494:Fat1 UTSW 8 44,950,542 (GRCm38) missense probably damaging 1.00
R0506:Fat1 UTSW 8 45,022,951 (GRCm38) missense probably damaging 0.99
R0512:Fat1 UTSW 8 44,951,332 (GRCm38) nonsense probably null
R0624:Fat1 UTSW 8 45,051,168 (GRCm38) missense possibly damaging 0.46
R0701:Fat1 UTSW 8 45,026,553 (GRCm38) missense probably benign 0.00
R0723:Fat1 UTSW 8 45,026,749 (GRCm38) missense probably damaging 1.00
R0787:Fat1 UTSW 8 45,040,555 (GRCm38) missense probably damaging 1.00
R0788:Fat1 UTSW 8 45,023,983 (GRCm38) missense probably benign 0.27
R0862:Fat1 UTSW 8 45,018,037 (GRCm38) missense probably damaging 1.00
R0864:Fat1 UTSW 8 45,018,037 (GRCm38) missense probably damaging 1.00
R0907:Fat1 UTSW 8 45,026,598 (GRCm38) missense probably benign 0.08
R0962:Fat1 UTSW 8 45,033,326 (GRCm38) splice site probably benign
R1051:Fat1 UTSW 8 45,044,506 (GRCm38) missense probably damaging 1.00
R1156:Fat1 UTSW 8 45,039,890 (GRCm38) missense possibly damaging 0.94
R1237:Fat1 UTSW 8 45,044,279 (GRCm38) missense probably damaging 1.00
R1468:Fat1 UTSW 8 45,010,545 (GRCm38) missense probably damaging 1.00
R1468:Fat1 UTSW 8 45,010,545 (GRCm38) missense probably damaging 1.00
R1478:Fat1 UTSW 8 45,025,622 (GRCm38) missense probably damaging 0.99
R1482:Fat1 UTSW 8 44,953,244 (GRCm38) missense probably benign 0.04
R1496:Fat1 UTSW 8 45,033,390 (GRCm38) missense probably damaging 1.00
R1498:Fat1 UTSW 8 45,025,484 (GRCm38) nonsense probably null
R1508:Fat1 UTSW 8 45,026,862 (GRCm38) missense probably benign 0.01
R1577:Fat1 UTSW 8 45,023,383 (GRCm38) missense probably benign 0.30
R1646:Fat1 UTSW 8 45,018,042 (GRCm38) missense probably damaging 1.00
R1652:Fat1 UTSW 8 45,025,178 (GRCm38) nonsense probably null
R1656:Fat1 UTSW 8 45,025,530 (GRCm38) nonsense probably null
R1662:Fat1 UTSW 8 44,953,164 (GRCm38) missense probably benign 0.20
R1672:Fat1 UTSW 8 45,036,835 (GRCm38) missense probably damaging 1.00
R1704:Fat1 UTSW 8 45,025,576 (GRCm38) missense probably damaging 1.00
R1708:Fat1 UTSW 8 45,024,792 (GRCm38) missense probably damaging 1.00
R1710:Fat1 UTSW 8 45,010,482 (GRCm38) missense probably benign 0.00
R1812:Fat1 UTSW 8 45,036,803 (GRCm38) missense probably damaging 1.00
R1872:Fat1 UTSW 8 45,038,349 (GRCm38) missense probably damaging 1.00
R1872:Fat1 UTSW 8 44,953,304 (GRCm38) missense probably benign 0.01
R1883:Fat1 UTSW 8 45,051,147 (GRCm38) missense probably benign 0.17
R1893:Fat1 UTSW 8 45,023,856 (GRCm38) missense probably damaging 1.00
R1930:Fat1 UTSW 8 45,044,228 (GRCm38) missense possibly damaging 0.91
R1931:Fat1 UTSW 8 45,044,228 (GRCm38) missense possibly damaging 0.91
R1952:Fat1 UTSW 8 45,033,926 (GRCm38) missense probably benign 0.00
R1957:Fat1 UTSW 8 45,040,682 (GRCm38) missense probably damaging 1.00
R1999:Fat1 UTSW 8 44,952,393 (GRCm38) missense probably damaging 0.96
R2019:Fat1 UTSW 8 45,023,746 (GRCm38) missense probably damaging 1.00
R2062:Fat1 UTSW 8 45,026,704 (GRCm38) missense probably damaging 1.00
R2062:Fat1 UTSW 8 45,024,332 (GRCm38) missense probably damaging 1.00
R2117:Fat1 UTSW 8 45,037,463 (GRCm38) missense probably benign 0.33
R2196:Fat1 UTSW 8 45,024,646 (GRCm38) missense probably damaging 1.00
R2204:Fat1 UTSW 8 45,023,700 (GRCm38) missense probably damaging 1.00
R2256:Fat1 UTSW 8 44,950,371 (GRCm38) missense probably damaging 1.00
R2409:Fat1 UTSW 8 45,040,530 (GRCm38) splice site probably benign
R2416:Fat1 UTSW 8 45,026,383 (GRCm38) missense probably damaging 1.00
R3021:Fat1 UTSW 8 45,044,011 (GRCm38) missense probably damaging 1.00
R3108:Fat1 UTSW 8 45,045,173 (GRCm38) splice site probably null
R3109:Fat1 UTSW 8 45,045,173 (GRCm38) splice site probably null
R3196:Fat1 UTSW 8 44,951,868 (GRCm38) missense probably benign 0.00
R3683:Fat1 UTSW 8 45,017,938 (GRCm38) missense probably benign
R3732:Fat1 UTSW 8 44,953,269 (GRCm38) missense possibly damaging 0.85
R3732:Fat1 UTSW 8 44,953,269 (GRCm38) missense possibly damaging 0.85
R3733:Fat1 UTSW 8 44,953,269 (GRCm38) missense possibly damaging 0.85
R3753:Fat1 UTSW 8 45,025,479 (GRCm38) missense probably damaging 0.97
R3905:Fat1 UTSW 8 45,023,035 (GRCm38) missense probably benign 0.00
R3907:Fat1 UTSW 8 45,023,035 (GRCm38) missense probably benign 0.00
R3908:Fat1 UTSW 8 45,023,035 (GRCm38) missense probably benign 0.00
R4060:Fat1 UTSW 8 45,025,481 (GRCm38) missense probably benign 0.09
R4061:Fat1 UTSW 8 45,025,481 (GRCm38) missense probably benign 0.09
R4062:Fat1 UTSW 8 45,025,481 (GRCm38) missense probably benign 0.09
R4063:Fat1 UTSW 8 45,025,481 (GRCm38) missense probably benign 0.09
R4078:Fat1 UTSW 8 44,989,122 (GRCm38) missense probably damaging 0.99
R4105:Fat1 UTSW 8 45,036,851 (GRCm38) missense probably damaging 1.00
R4118:Fat1 UTSW 8 45,050,944 (GRCm38) missense probably damaging 1.00
R4118:Fat1 UTSW 8 45,010,437 (GRCm38) missense probably damaging 1.00
R4161:Fat1 UTSW 8 45,036,787 (GRCm38) missense probably benign 0.00
R4364:Fat1 UTSW 8 44,952,962 (GRCm38) missense probably benign 0.01
R4394:Fat1 UTSW 8 44,952,346 (GRCm38) missense probably damaging 0.98
R4395:Fat1 UTSW 8 44,952,346 (GRCm38) missense probably damaging 0.98
R4396:Fat1 UTSW 8 44,952,346 (GRCm38) missense probably damaging 0.98
R4412:Fat1 UTSW 8 45,023,599 (GRCm38) missense probably damaging 0.99
R4542:Fat1 UTSW 8 45,041,894 (GRCm38) missense probably damaging 1.00
R4591:Fat1 UTSW 8 45,026,242 (GRCm38) missense probably benign
R4606:Fat1 UTSW 8 44,950,683 (GRCm38) missense possibly damaging 0.47
R4612:Fat1 UTSW 8 45,025,147 (GRCm38) missense probably damaging 1.00
R4730:Fat1 UTSW 8 45,033,477 (GRCm38) missense probably damaging 1.00
R4778:Fat1 UTSW 8 45,038,326 (GRCm38) missense probably benign 0.04
R4824:Fat1 UTSW 8 44,989,114 (GRCm38) missense probably damaging 1.00
R4829:Fat1 UTSW 8 45,036,162 (GRCm38) missense probably damaging 1.00
R4832:Fat1 UTSW 8 45,013,065 (GRCm38) missense possibly damaging 0.95
R4849:Fat1 UTSW 8 45,012,970 (GRCm38) missense probably benign 0.15
R4896:Fat1 UTSW 8 44,951,280 (GRCm38) missense possibly damaging 0.68
R4927:Fat1 UTSW 8 45,022,963 (GRCm38) missense probably damaging 0.96
R4941:Fat1 UTSW 8 45,036,275 (GRCm38) missense probably benign 0.00
R5011:Fat1 UTSW 8 45,031,263 (GRCm38) critical splice acceptor site probably null
R5040:Fat1 UTSW 8 45,023,380 (GRCm38) missense probably damaging 1.00
R5112:Fat1 UTSW 8 45,024,282 (GRCm38) missense probably damaging 1.00
R5151:Fat1 UTSW 8 44,951,814 (GRCm38) missense possibly damaging 0.74
R5161:Fat1 UTSW 8 44,952,512 (GRCm38) missense probably benign 0.00
R5162:Fat1 UTSW 8 45,025,809 (GRCm38) missense probably benign 0.02
R5353:Fat1 UTSW 8 45,036,131 (GRCm38) missense probably benign 0.13
R5425:Fat1 UTSW 8 45,025,885 (GRCm38) missense possibly damaging 0.64
R5458:Fat1 UTSW 8 45,013,053 (GRCm38) missense probably damaging 1.00
R5479:Fat1 UTSW 8 45,036,875 (GRCm38) missense possibly damaging 0.88
R5543:Fat1 UTSW 8 45,023,479 (GRCm38) missense probably damaging 0.99
R5569:Fat1 UTSW 8 45,039,836 (GRCm38) missense probably damaging 0.98
R5610:Fat1 UTSW 8 44,953,072 (GRCm38) nonsense probably null
R5734:Fat1 UTSW 8 45,051,209 (GRCm38) missense probably damaging 0.99
R5832:Fat1 UTSW 8 45,017,423 (GRCm38) missense possibly damaging 0.65
R5860:Fat1 UTSW 8 45,051,129 (GRCm38) missense probably benign
R5886:Fat1 UTSW 8 45,033,395 (GRCm38) missense probably damaging 1.00
R5886:Fat1 UTSW 8 45,027,681 (GRCm38) critical splice donor site probably null
R5919:Fat1 UTSW 8 45,026,873 (GRCm38) critical splice donor site probably null
R5930:Fat1 UTSW 8 45,044,036 (GRCm38) missense probably benign 0.10
R5960:Fat1 UTSW 8 45,033,368 (GRCm38) missense probably damaging 1.00
R5988:Fat1 UTSW 8 45,029,456 (GRCm38) missense probably benign 0.00
R6166:Fat1 UTSW 8 44,952,485 (GRCm38) missense probably damaging 1.00
R6184:Fat1 UTSW 8 44,953,392 (GRCm38) missense probably benign 0.00
R6208:Fat1 UTSW 8 45,027,613 (GRCm38) missense probably damaging 0.99
R6351:Fat1 UTSW 8 45,033,495 (GRCm38) missense probably damaging 1.00
R6391:Fat1 UTSW 8 44,952,342 (GRCm38) missense possibly damaging 0.69
R6701:Fat1 UTSW 8 44,950,681 (GRCm38) missense probably damaging 1.00
R6702:Fat1 UTSW 8 44,953,046 (GRCm38) missense probably benign 0.28
R6703:Fat1 UTSW 8 44,953,046 (GRCm38) missense probably benign 0.28
R6704:Fat1 UTSW 8 45,024,373 (GRCm38) missense probably damaging 1.00
R6822:Fat1 UTSW 8 45,026,404 (GRCm38) missense probably damaging 1.00
R6852:Fat1 UTSW 8 45,035,598 (GRCm38) missense possibly damaging 0.46
R6863:Fat1 UTSW 8 45,044,464 (GRCm38) missense probably damaging 1.00
R6885:Fat1 UTSW 8 44,952,452 (GRCm38) missense possibly damaging 0.94
R6912:Fat1 UTSW 8 45,051,023 (GRCm38) missense probably benign 0.00
R6927:Fat1 UTSW 8 45,024,495 (GRCm38) missense probably benign 0.41
R6964:Fat1 UTSW 8 45,043,945 (GRCm38) missense probably damaging 1.00
R7010:Fat1 UTSW 8 44,953,349 (GRCm38) nonsense probably null
R7062:Fat1 UTSW 8 44,950,216 (GRCm38) start codon destroyed probably null 0.99
R7063:Fat1 UTSW 8 45,040,775 (GRCm38) missense probably benign 0.09
R7071:Fat1 UTSW 8 44,989,108 (GRCm38) missense possibly damaging 0.67
R7117:Fat1 UTSW 8 45,031,468 (GRCm38) missense probably damaging 0.98
R7146:Fat1 UTSW 8 44,950,925 (GRCm38) missense probably benign
R7210:Fat1 UTSW 8 45,023,503 (GRCm38) missense probably damaging 1.00
R7227:Fat1 UTSW 8 45,010,609 (GRCm38) missense probably benign 0.08
R7270:Fat1 UTSW 8 45,037,438 (GRCm38) missense probably damaging 1.00
R7373:Fat1 UTSW 8 45,026,665 (GRCm38) missense probably damaging 1.00
R7390:Fat1 UTSW 8 44,952,474 (GRCm38) missense possibly damaging 0.81
R7465:Fat1 UTSW 8 45,044,152 (GRCm38) missense probably benign 0.35
R7476:Fat1 UTSW 8 45,031,274 (GRCm38) missense probably benign 0.01
R7483:Fat1 UTSW 8 45,023,160 (GRCm38) missense probably benign 0.13
R7484:Fat1 UTSW 8 45,036,184 (GRCm38) missense probably damaging 1.00
R7526:Fat1 UTSW 8 45,023,427 (GRCm38) missense probably damaging 1.00
R7549:Fat1 UTSW 8 44,988,994 (GRCm38) missense probably benign 0.01
R7554:Fat1 UTSW 8 45,037,165 (GRCm38) missense possibly damaging 0.88
R7620:Fat1 UTSW 8 45,009,850 (GRCm38) missense possibly damaging 0.95
R7652:Fat1 UTSW 8 44,953,299 (GRCm38) missense probably damaging 1.00
R7694:Fat1 UTSW 8 44,988,930 (GRCm38) critical splice acceptor site probably null
R7746:Fat1 UTSW 8 44,951,633 (GRCm38) missense probably damaging 0.96
R7762:Fat1 UTSW 8 45,037,337 (GRCm38) missense probably damaging 0.99
R7762:Fat1 UTSW 8 45,023,322 (GRCm38) missense probably damaging 1.00
R7782:Fat1 UTSW 8 44,950,911 (GRCm38) missense probably damaging 1.00
R7801:Fat1 UTSW 8 45,042,223 (GRCm38) missense probably damaging 1.00
R7807:Fat1 UTSW 8 45,041,973 (GRCm38) missense probably damaging 1.00
R7821:Fat1 UTSW 8 44,950,224 (GRCm38) missense probably benign
R7869:Fat1 UTSW 8 45,051,222 (GRCm38) missense probably benign 0.02
R8034:Fat1 UTSW 8 44,951,691 (GRCm38) missense probably benign 0.28
R8094:Fat1 UTSW 8 44,952,702 (GRCm38) missense probably damaging 0.98
R8111:Fat1 UTSW 8 45,026,058 (GRCm38) missense possibly damaging 0.94
R8220:Fat1 UTSW 8 45,039,956 (GRCm38) missense probably null
R8221:Fat1 UTSW 8 44,953,353 (GRCm38) missense
R8233:Fat1 UTSW 8 44,952,018 (GRCm38) missense
R8250:Fat1 UTSW 8 44,953,299 (GRCm38) missense probably damaging 1.00
R8279:Fat1 UTSW 8 45,030,347 (GRCm38) critical splice donor site probably null
R8726:Fat1 UTSW 8 45,024,169 (GRCm38) missense probably benign 0.23
R8875:Fat1 UTSW 8 45,040,563 (GRCm38) missense probably damaging 1.00
R8937:Fat1 UTSW 8 45,030,313 (GRCm38) missense probably damaging 1.00
R8950:Fat1 UTSW 8 45,023,121 (GRCm38) missense probably damaging 1.00
R8971:Fat1 UTSW 8 45,042,294 (GRCm38) missense probably damaging 1.00
R8976:Fat1 UTSW 8 45,031,295 (GRCm38) missense probably benign 0.02
R9000:Fat1 UTSW 8 45,044,550 (GRCm38) nonsense probably null
R9032:Fat1 UTSW 8 45,039,857 (GRCm38) missense probably benign 0.01
R9076:Fat1 UTSW 8 45,039,901 (GRCm38) missense probably damaging 1.00
R9083:Fat1 UTSW 8 45,038,299 (GRCm38) missense probably benign 0.00
R9083:Fat1 UTSW 8 45,013,090 (GRCm38) missense possibly damaging 0.76
R9103:Fat1 UTSW 8 44,951,813 (GRCm38) missense probably benign 0.38
R9124:Fat1 UTSW 8 45,025,027 (GRCm38) missense possibly damaging 0.48
R9124:Fat1 UTSW 8 44,950,326 (GRCm38) missense probably benign
R9128:Fat1 UTSW 8 45,009,841 (GRCm38) missense probably benign 0.14
R9148:Fat1 UTSW 8 44,952,645 (GRCm38) missense possibly damaging 0.81
R9162:Fat1 UTSW 8 44,951,315 (GRCm38) missense probably damaging 1.00
R9209:Fat1 UTSW 8 44,951,754 (GRCm38) missense possibly damaging 0.80
R9276:Fat1 UTSW 8 45,035,477 (GRCm38) missense probably damaging 0.99
R9303:Fat1 UTSW 8 45,010,461 (GRCm38) missense probably damaging 1.00
R9319:Fat1 UTSW 8 44,953,023 (GRCm38) missense probably damaging 1.00
R9392:Fat1 UTSW 8 45,023,191 (GRCm38) missense probably damaging 1.00
R9616:Fat1 UTSW 8 44,953,038 (GRCm38) missense probably damaging 0.99
R9712:Fat1 UTSW 8 45,017,380 (GRCm38) missense probably benign 0.05
R9756:Fat1 UTSW 8 45,043,937 (GRCm38) missense probably damaging 0.96
RF001:Fat1 UTSW 8 44,988,966 (GRCm38) missense probably benign 0.00
X0064:Fat1 UTSW 8 45,025,734 (GRCm38) missense possibly damaging 0.58
Z1088:Fat1 UTSW 8 45,023,807 (GRCm38) missense possibly damaging 0.88
Z1176:Fat1 UTSW 8 45,036,838 (GRCm38) missense probably damaging 1.00
Z1176:Fat1 UTSW 8 45,023,596 (GRCm38) missense possibly damaging 0.65
Z1176:Fat1 UTSW 8 44,950,598 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTATTACAGGTGGCCAGGAG -3'
(R):5'- TCCACTGCCTTGACGATCAG -3'

Sequencing Primer
(F):5'- ATGGCAGCCAAAGACTTG -3'
(R):5'- GATCAGCGTGTAATGGTCTCTCAC -3'
Posted On 2014-10-16