Incidental Mutation 'R2257:Nob1'
ID243466
Institutional Source Beutler Lab
Gene Symbol Nob1
Ensembl Gene ENSMUSG00000003848
Gene NameNIN1/RPN12 binding protein 1 homolog
SynonymsART-4, Nob1p, Psmd8bp1, 1700021I09Rik
MMRRC Submission 040257-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2257 (G1)
Quality Score212
Status Validated
Chromosome8
Chromosomal Location107412486-107425051 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 107417097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003946] [ENSMUST00000169311]
Predicted Effect probably benign
Transcript: ENSMUST00000003946
SMART Domains Protein: ENSMUSP00000003946
Gene: ENSMUSG00000003848

DomainStartEndE-ValueType
PINc 5 108 2.28e-6 SMART
Pfam:AF1Q 135 211 1.8e-30 PFAM
Pfam:NOB1_Zn_bind 251 323 1e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000076585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163973
Predicted Effect probably benign
Transcript: ENSMUST00000165266
SMART Domains Protein: ENSMUSP00000129298
Gene: ENSMUSG00000003848

DomainStartEndE-ValueType
Blast:PINc 5 61 9e-34 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169311
SMART Domains Protein: ENSMUSP00000126868
Gene: ENSMUSG00000003848

DomainStartEndE-ValueType
PINc 5 108 2.28e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170796
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In yeast, over 200 protein and RNA cofactors are required for ribosome assembly, and these are generally conserved in eukaryotes. These factors orchestrate modification and cleavage of the initial 35S precursor rRNA transcript into the mature 18S, 5.8S, and 25S rRNAs, folding of the rRNA, and binding of ribosomal proteins and 5S RNA. Nob1 is involved in pre-rRNA processing. In a late cytoplasmic processing step, Nob1 cleaves a 20S rRNA intermediate at cleavage site D to produce the mature 18S rRNA (Lamanna and Karbstein, 2009 [PubMed 19706509]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Kif4 A T X: 100,726,131 N1126Y probably benign Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mical3 A T 6: 121,033,735 S429T possibly damaging Het
Mrps35 A G 6: 147,070,627 E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmprss7 A T 16: 45,686,333 M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Nob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Nob1 APN 8 107424728 splice site probably benign
IGL01661:Nob1 APN 8 107413182 missense probably damaging 1.00
IGL02110:Nob1 APN 8 107416172 makesense probably null
IGL03373:Nob1 APN 8 107418046 intron probably benign
PIT4531001:Nob1 UTSW 8 107418417 missense probably benign 0.01
R0627:Nob1 UTSW 8 107416224 missense probably damaging 1.00
R1181:Nob1 UTSW 8 107421490 missense probably damaging 1.00
R1264:Nob1 UTSW 8 107421504 missense probably damaging 0.99
R4402:Nob1 UTSW 8 107418488 intron probably benign
R5330:Nob1 UTSW 8 107416249 missense probably damaging 1.00
R6907:Nob1 UTSW 8 107416228 missense possibly damaging 0.90
R7702:Nob1 UTSW 8 107413105 nonsense probably null
X0017:Nob1 UTSW 8 107424833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAGACCCTCACACATGTG -3'
(R):5'- CTTGGAATTGCCCAGTGACC -3'

Sequencing Primer
(F):5'- AGGGATCTCAGTGTGGCAC -3'
(R):5'- AGTGACCCGCGTCCTGTC -3'
Posted On2014-10-16