Incidental Mutation 'R2257:Cep162'
ID243471
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission 040257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R2257 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87206914 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 972 (D972Y)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably damaging
Transcript: ENSMUST00000093802
AA Change: D972Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: D972Y

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139301
Meta Mutation Damage Score 0.2844 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Kif4 A T X: 100,726,131 N1126Y probably benign Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mical3 A T 6: 121,033,735 S429T possibly damaging Het
Mrps35 A G 6: 147,070,627 E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nob1 A G 8: 107,417,097 probably benign Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmprss7 A T 16: 45,686,333 M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACATGGAATCACCCTGGTGG -3'
(R):5'- AAGCTGTAAACAACATGACTGGTG -3'

Sequencing Primer
(F):5'- CCTGGTGGGCAAGGATG -3'
(R):5'- GACTGGTGTAGCTTATTAAACTGC -3'
Posted On2014-10-16