Incidental Mutation 'R2257:Dnaaf11'
ID 243479
Institutional Source Beutler Lab
Gene Symbol Dnaaf11
Ensembl Gene ENSMUSG00000022375
Gene Name dynein axonemal assembly factor 11
Synonyms LRTP, Lrrc6
MMRRC Submission 040257-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.213) question?
Stock # R2257 (G1)
Quality Score 195
Status Validated
Chromosome 15
Chromosomal Location 66251707-66372759 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 66309436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023006]
AlphaFold O88978
Predicted Effect probably benign
Transcript: ENSMUST00000023006
SMART Domains Protein: ENSMUSP00000023006
Gene: ENSMUSG00000022375

DomainStartEndE-ValueType
internal_repeat_1 23 65 8.03e-6 PROSPERO
internal_repeat_1 68 109 8.03e-6 PROSPERO
LRRcap 128 146 2.42e-2 SMART
low complexity region 178 204 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 449 471 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several leucine-rich repeat domains and appears to be involved in the motility of cilia. Defects in this gene are a cause of primary ciliary dyskinesia-19 (CILD19). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4, 11 and 22. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik A T X: 69,438,012 (GRCm39) W94R probably damaging Het
Abcc3 C T 11: 94,254,420 (GRCm39) V693M probably damaging Het
Acp7 A C 7: 28,313,838 (GRCm39) W399G probably damaging Het
Ap1s1 T C 5: 137,070,633 (GRCm39) Y94C possibly damaging Het
Arhgap32 T C 9: 32,158,793 (GRCm39) I186T probably damaging Het
Atg4a A G X: 139,890,984 (GRCm39) I91V probably benign Het
Atp7b T G 8: 22,488,282 (GRCm39) T1102P probably damaging Het
Cabs1 T C 5: 88,128,074 (GRCm39) S242P probably damaging Het
Cass4 T C 2: 172,269,390 (GRCm39) F493L probably damaging Het
Cass4 C T 2: 172,274,478 (GRCm39) P753L probably damaging Het
Cdk14 T A 5: 4,938,924 (GRCm39) M433L probably benign Het
Cep162 C A 9: 87,088,967 (GRCm39) D972Y probably damaging Het
Cfap100 C G 6: 90,390,802 (GRCm39) R184P possibly damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Clasrp A G 7: 19,320,510 (GRCm39) probably benign Het
Copb1 T A 7: 113,853,110 (GRCm39) D29V possibly damaging Het
Cyp2b9 G A 7: 25,873,030 (GRCm39) probably null Het
Dhx36 C T 3: 62,385,064 (GRCm39) G683S probably damaging Het
Dnah10 T A 5: 124,838,301 (GRCm39) I1110N probably damaging Het
Dnajc3 C G 14: 119,210,114 (GRCm39) P322A probably benign Het
Eml4 A G 17: 83,785,189 (GRCm39) T785A probably damaging Het
Fam228a T C 12: 4,787,775 (GRCm39) probably benign Het
Fam83e A T 7: 45,378,193 (GRCm39) K406* probably null Het
Fam83e A T 7: 45,378,194 (GRCm39) K406M possibly damaging Het
Fam90a1a T A 8: 22,453,533 (GRCm39) L296Q possibly damaging Het
Fat1 A G 8: 45,403,408 (GRCm39) Y53C probably damaging Het
Fcrl2 T C 3: 87,166,928 (GRCm39) I22V probably damaging Het
Fryl T A 5: 73,230,187 (GRCm39) N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 (GRCm39) M453V possibly damaging Het
Grm8 A T 6: 27,760,224 (GRCm39) C369S probably damaging Het
Hdc G A 2: 126,458,000 (GRCm39) probably null Het
Hsf3 A T X: 95,363,928 (GRCm39) L191* probably null Het
Iqca1l C T 5: 24,757,038 (GRCm39) probably benign Het
Kif4 A T X: 99,769,737 (GRCm39) N1126Y probably benign Het
Lat2 T C 5: 134,631,481 (GRCm39) D191G probably damaging Het
Lipt2 C T 7: 99,808,601 (GRCm39) T38I probably benign Het
Lmo7 T C 14: 102,137,566 (GRCm39) L634P probably damaging Het
Magea2 A T X: 153,810,855 (GRCm39) L243Q probably damaging Het
Mctp2 A G 7: 71,835,568 (GRCm39) L543P probably damaging Het
Mgat4a T C 1: 37,529,394 (GRCm39) N24D probably benign Het
Mical3 A T 6: 121,010,696 (GRCm39) S429T possibly damaging Het
Mrps35 A G 6: 146,972,125 (GRCm39) E256G possibly damaging Het
Mybbp1a T A 11: 72,337,021 (GRCm39) S586T probably benign Het
Myo1e G A 9: 70,285,655 (GRCm39) probably null Het
Nob1 A G 8: 108,143,729 (GRCm39) probably benign Het
Nom1 T A 5: 29,642,750 (GRCm39) V417D probably damaging Het
Nphs1 A T 7: 30,167,417 (GRCm39) I782F possibly damaging Het
Numa1 A G 7: 101,649,998 (GRCm39) E1243G probably damaging Het
Or52e7 A G 7: 104,685,026 (GRCm39) Y207C probably benign Het
Or7g27 A G 9: 19,249,789 (GRCm39) E11G probably benign Het
Padi4 G A 4: 140,487,251 (GRCm39) T217I possibly damaging Het
Pias3 C T 3: 96,606,962 (GRCm39) T75I probably benign Het
Ppp1r37 G T 7: 19,295,943 (GRCm39) probably benign Het
Prrc2a G A 17: 35,380,044 (GRCm39) P185L unknown Het
Prss57 C T 10: 79,623,204 (GRCm39) C81Y probably damaging Het
Psen1 C T 12: 83,761,594 (GRCm39) S132L probably damaging Het
Ranbp6 A G 19: 29,788,949 (GRCm39) S468P possibly damaging Het
Sla2 G A 2: 156,717,862 (GRCm39) R137C probably damaging Het
Slc2a9 T C 5: 38,610,542 (GRCm39) T86A probably damaging Het
Slco1a6 A T 6: 142,036,742 (GRCm39) M555K probably benign Het
Thoc1 C A 18: 9,993,466 (GRCm39) D608E possibly damaging Het
Tmem121b A T 6: 120,469,030 (GRCm39) Y562* probably null Het
Tmem121b A G 6: 120,469,032 (GRCm39) Y562H probably damaging Het
Tmprss7 A T 16: 45,506,696 (GRCm39) M122K possibly damaging Het
Tmub1 C A 5: 24,651,922 (GRCm39) G14V possibly damaging Het
Uap1 A T 1: 169,986,312 (GRCm39) probably benign Het
Ugdh A T 5: 65,574,458 (GRCm39) probably benign Het
Vmn2r59 A T 7: 41,661,669 (GRCm39) C715* probably null Het
Vps13a G A 19: 16,659,538 (GRCm39) T1663I possibly damaging Het
Vps13c A C 9: 67,860,228 (GRCm39) I2815L possibly damaging Het
Zc3h3 G T 15: 75,711,415 (GRCm39) Q349K possibly damaging Het
Other mutations in Dnaaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Dnaaf11 APN 15 66,353,082 (GRCm39) splice site probably benign
IGL01313:Dnaaf11 APN 15 66,252,362 (GRCm39) missense probably benign 0.00
IGL01739:Dnaaf11 APN 15 66,321,326 (GRCm39) missense probably benign
IGL01863:Dnaaf11 APN 15 66,268,823 (GRCm39) splice site probably benign
IGL02074:Dnaaf11 APN 15 66,361,339 (GRCm39) missense probably damaging 1.00
IGL02146:Dnaaf11 APN 15 66,361,375 (GRCm39) missense probably benign 0.08
IGL02146:Dnaaf11 APN 15 66,361,374 (GRCm39) nonsense probably null
IGL03194:Dnaaf11 APN 15 66,314,048 (GRCm39) missense probably benign 0.03
droopy UTSW 15 66,319,525 (GRCm39) splice site probably benign
R0087:Dnaaf11 UTSW 15 66,341,824 (GRCm39) missense probably benign 0.00
R0178:Dnaaf11 UTSW 15 66,325,950 (GRCm39) missense probably benign 0.05
R0463:Dnaaf11 UTSW 15 66,252,323 (GRCm39) missense probably benign
R0539:Dnaaf11 UTSW 15 66,319,455 (GRCm39) missense probably damaging 0.99
R0608:Dnaaf11 UTSW 15 66,252,323 (GRCm39) missense probably benign
R1124:Dnaaf11 UTSW 15 66,310,264 (GRCm39) missense possibly damaging 0.92
R2209:Dnaaf11 UTSW 15 66,321,400 (GRCm39) missense probably benign 0.00
R2844:Dnaaf11 UTSW 15 66,319,525 (GRCm39) splice site probably benign
R2867:Dnaaf11 UTSW 15 66,310,257 (GRCm39) nonsense probably null
R2867:Dnaaf11 UTSW 15 66,310,257 (GRCm39) nonsense probably null
R4281:Dnaaf11 UTSW 15 66,252,378 (GRCm39) missense probably benign 0.35
R5163:Dnaaf11 UTSW 15 66,314,067 (GRCm39) missense probably benign 0.01
R5636:Dnaaf11 UTSW 15 66,372,665 (GRCm39) splice site probably null
R6365:Dnaaf11 UTSW 15 66,325,983 (GRCm39) missense probably benign 0.00
R6567:Dnaaf11 UTSW 15 66,310,228 (GRCm39) missense probably benign 0.43
R7751:Dnaaf11 UTSW 15 66,321,412 (GRCm39) missense probably benign 0.00
R7774:Dnaaf11 UTSW 15 66,321,401 (GRCm39) missense probably benign 0.01
R7963:Dnaaf11 UTSW 15 66,252,366 (GRCm39) missense probably damaging 1.00
R9018:Dnaaf11 UTSW 15 66,321,479 (GRCm39) missense probably benign 0.01
R9499:Dnaaf11 UTSW 15 66,361,483 (GRCm39) missense probably damaging 0.97
Z1177:Dnaaf11 UTSW 15 66,341,748 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACCTTGAGCTCTAGTCACAC -3'
(R):5'- GGCTGGTGAATACTCTTTAGATTGC -3'

Sequencing Primer
(F):5'- TTGAGCTCTAGTCACACCCCAATG -3'
(R):5'- GCACATAAAATCAGCTATCATGGTTC -3'
Posted On 2014-10-16