Incidental Mutation 'R2257:Tmprss7'
ID243481
Institutional Source Beutler Lab
Gene Symbol Tmprss7
Ensembl Gene ENSMUSG00000033177
Gene Nametransmembrane serine protease 7
Synonymsmatriptase-3, B230219I23Rik, LOC385645
MMRRC Submission 040257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R2257 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45656315-45693658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45686333 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 122 (M122K)
Ref Sequence ENSEMBL: ENSMUSP00000110209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114562]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114562
AA Change: M122K

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110209
Gene: ENSMUSG00000033177
AA Change: M122K

DomainStartEndE-ValueType
low complexity region 28 55 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
Pfam:SEA 94 198 4.6e-23 PFAM
CUB 233 346 9.35e-4 SMART
Pfam:CUB 351 454 3e-7 PFAM
LDLa 469 506 5.63e-13 SMART
LDLa 510 541 5.56e-2 SMART
LDLa 544 582 8.95e-7 SMART
Tryp_SPc 591 821 7.17e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178323
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Kif4 A T X: 100,726,131 N1126Y probably benign Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mical3 A T 6: 121,033,735 S429T possibly damaging Het
Mrps35 A G 6: 147,070,627 E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nob1 A G 8: 107,417,097 probably benign Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Tmprss7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tmprss7 APN 16 45663368 missense probably benign
IGL00985:Tmprss7 APN 16 45662322 missense probably damaging 1.00
IGL01115:Tmprss7 APN 16 45660789 missense probably damaging 1.00
IGL01296:Tmprss7 APN 16 45684574 missense probably damaging 0.98
IGL01298:Tmprss7 APN 16 45664175 missense probably benign 0.00
IGL01459:Tmprss7 APN 16 45663343 missense probably benign 0.00
IGL01785:Tmprss7 APN 16 45680634 missense probably damaging 1.00
IGL02313:Tmprss7 APN 16 45681593 missense probably damaging 1.00
IGL02893:Tmprss7 APN 16 45669528 missense possibly damaging 0.65
IGL02940:Tmprss7 APN 16 45656455 missense probably damaging 1.00
IGL03291:Tmprss7 APN 16 45680748 missense probably benign
amalgum UTSW 16 45683510 missense probably benign 0.15
fusion UTSW 16 45690760 missense probably damaging 1.00
steely UTSW 16 45667606 nonsense probably null
P0019:Tmprss7 UTSW 16 45680733 missense probably benign
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0092:Tmprss7 UTSW 16 45667596 missense probably damaging 1.00
R0178:Tmprss7 UTSW 16 45690843 missense probably damaging 1.00
R0219:Tmprss7 UTSW 16 45656457 missense probably damaging 1.00
R0332:Tmprss7 UTSW 16 45680638 missense probably benign 0.01
R0607:Tmprss7 UTSW 16 45669551 missense probably damaging 0.97
R0669:Tmprss7 UTSW 16 45677962 nonsense probably null
R0783:Tmprss7 UTSW 16 45667606 nonsense probably null
R1447:Tmprss7 UTSW 16 45680670 missense probably benign
R1538:Tmprss7 UTSW 16 45679390 missense probably benign 0.44
R1564:Tmprss7 UTSW 16 45662153 critical splice donor site probably null
R1912:Tmprss7 UTSW 16 45656548 nonsense probably null
R1932:Tmprss7 UTSW 16 45684593 nonsense probably null
R3840:Tmprss7 UTSW 16 45660832 nonsense probably null
R4232:Tmprss7 UTSW 16 45656573 missense probably damaging 1.00
R4332:Tmprss7 UTSW 16 45686327 missense probably benign 0.00
R4685:Tmprss7 UTSW 16 45679348 missense probably benign
R4712:Tmprss7 UTSW 16 45690760 missense probably damaging 1.00
R4822:Tmprss7 UTSW 16 45663316 missense probably damaging 1.00
R5368:Tmprss7 UTSW 16 45660889 missense probably damaging 1.00
R5386:Tmprss7 UTSW 16 45669528 missense possibly damaging 0.65
R5468:Tmprss7 UTSW 16 45656448 missense probably damaging 1.00
R5526:Tmprss7 UTSW 16 45660904 missense probably damaging 1.00
R5719:Tmprss7 UTSW 16 45686430 missense probably damaging 0.99
R6149:Tmprss7 UTSW 16 45673905 nonsense probably null
R6235:Tmprss7 UTSW 16 45658122 missense probably benign 0.03
R6358:Tmprss7 UTSW 16 45669573 missense probably benign 0.00
R6645:Tmprss7 UTSW 16 45690963 missense possibly damaging 0.90
R7187:Tmprss7 UTSW 16 45677954 missense possibly damaging 0.50
R7222:Tmprss7 UTSW 16 45690893 missense probably benign
R7634:Tmprss7 UTSW 16 45663274 missense probably benign 0.00
R7747:Tmprss7 UTSW 16 45683510 missense probably benign 0.15
R7776:Tmprss7 UTSW 16 45667651 missense probably benign 0.03
R7777:Tmprss7 UTSW 16 45660600 splice site probably null
R8222:Tmprss7 UTSW 16 45658098 missense probably damaging 0.99
T0975:Tmprss7 UTSW 16 45680733 missense probably benign
Z1176:Tmprss7 UTSW 16 45662256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGCGCGTGTATCTTAAAG -3'
(R):5'- GCTGAAATCGTTTTAGGAGACTCC -3'

Sequencing Primer
(F):5'- CGCGTGTATCTTAAAGCACAG -3'
(R):5'- TCCTGCCAACGTGCATCAG -3'
Posted On2014-10-16