Incidental Mutation 'R2257:Kif4'
ID243495
Institutional Source Beutler Lab
Gene Symbol Kif4
Ensembl Gene ENSMUSG00000034311
Gene Namekinesin family member 4
SynonymsN-5 kinesin, Kns4, D330050K22Rik
MMRRC Submission 040257-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R2257 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location100625737-100727214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100726131 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1126 (N1126Y)
Ref Sequence ENSEMBL: ENSMUSP00000048383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019503] [ENSMUST00000048962] [ENSMUST00000113744]
PDB Structure
Crystal Structure of the Kif4 Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif4 Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000019503
SMART Domains Protein: ENSMUSP00000019503
Gene: ENSMUSG00000019359

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 157 176 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
Pfam:GDPD 230 390 1.3e-26 PFAM
transmembrane domain 491 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048962
AA Change: N1126Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048383
Gene: ENSMUSG00000034311
AA Change: N1126Y

DomainStartEndE-ValueType
KISc 7 345 6.98e-183 SMART
low complexity region 352 368 N/A INTRINSIC
Blast:KISc 369 399 2e-8 BLAST
Blast:KISc 424 501 6e-27 BLAST
low complexity region 525 543 N/A INTRINSIC
coiled coil region 555 791 N/A INTRINSIC
coiled coil region 815 848 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
coiled coil region 935 1000 N/A INTRINSIC
CXC 1081 1123 1.66e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113744
SMART Domains Protein: ENSMUSP00000109373
Gene: ENSMUSG00000019359

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 157 176 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
Pfam:GDPD 230 390 1.3e-26 PFAM
transmembrane domain 491 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156336
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin 4 subfamily of kinesin related proteins. The encoded protein is an ATP dependent microtubule-based motor protein that is involved in the intracellular transport of membranous organelles. This protein also associates with condensed chromosome arms and may be involved in maintaining chromosome integrity during mitosis. This protein may also be involved in the organization of the central spindle prior to cytokinesis. A pseudogene of this gene is found on chromosome X.[provided by RefSeq, Mar 2010]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele appear normal at E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mical3 A T 6: 121,033,735 S429T possibly damaging Het
Mrps35 A G 6: 147,070,627 E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nob1 A G 8: 107,417,097 probably benign Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmprss7 A T 16: 45,686,333 M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Kif4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Kif4 APN X 100638354 missense probably benign 0.05
IGL02195:Kif4 APN X 100726216 missense probably damaging 1.00
R1398:Kif4 UTSW X 100689097 missense probably benign 0.00
R2114:Kif4 UTSW X 100665717 missense probably benign 0.26
R2115:Kif4 UTSW X 100665717 missense probably benign 0.26
R2117:Kif4 UTSW X 100665717 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGAGCATGTGAAGCCCTATGG -3'
(R):5'- AGTGCACAGCAATATCTTTCCC -3'

Sequencing Primer
(F):5'- GGCTTCTCCAAACAGTAGCTG -3'
(R):5'- CCTTCTATCAGAGCTAATGCAGAAG -3'
Posted On2014-10-16