Incidental Mutation 'R2258:Tigd4'
ID243513
Institutional Source Beutler Lab
Gene Symbol Tigd4
Ensembl Gene ENSMUSG00000047819
Gene Nametigger transposable element derived 4
SynonymsTigd4, C130063O11Rik
MMRRC Submission 040258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R2258 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84593574-84597032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84594293 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 172 (N172K)
Ref Sequence ENSEMBL: ENSMUSP00000052320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062623] [ENSMUST00000154148]
Predicted Effect probably benign
Transcript: ENSMUST00000062623
AA Change: N172K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052320
Gene: ENSMUSG00000047819
AA Change: N172K

DomainStartEndE-ValueType
Pfam:CENP-B_N 15 67 9e-14 PFAM
CENPB 81 146 5.52e-16 SMART
Pfam:DDE_1 211 375 4.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,618 N308S possibly damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Ang4 A G 14: 51,764,498 probably benign Het
Ap3d1 A G 10: 80,721,132 S315P probably benign Het
Arhgap15 G A 2: 44,386,347 G437R probably damaging Het
Cacna2d1 T C 5: 16,357,289 C810R probably damaging Het
Capn5 A G 7: 98,135,875 W131R probably damaging Het
Ccnj A G 19: 40,845,833 Q292R probably benign Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdk5r2 T C 1: 74,855,900 L268P probably damaging Het
Clrn2 A G 5: 45,453,962 D51G probably benign Het
Cntd1 T C 11: 101,284,856 S174P probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Col17a1 C T 19: 47,681,377 probably null Het
Cyp2a5 A G 7: 26,837,103 D169G possibly damaging Het
Cyp2c37 A G 19: 39,995,859 I264V possibly damaging Het
Cyp2j12 A G 4: 96,133,078 I97T probably damaging Het
Eif3b T C 5: 140,427,503 F354L possibly damaging Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
F5 T A 1: 164,192,181 S742T probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fam69b T C 2: 26,635,150 L157P probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fndc3b G T 3: 27,440,160 Q939K possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gm17689 C A 9: 36,581,865 V54L probably benign Het
Gm5065 A G 7: 5,359,402 M11V probably benign Het
Gm8994 A T 6: 136,328,561 M7L probably benign Het
Gpbar1 T C 1: 74,279,005 F136L probably benign Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hecw1 A T 13: 14,316,138 D756E probably benign Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Inpp4a T A 1: 37,377,696 S433T probably damaging Het
Ism2 C A 12: 87,280,074 V320L possibly damaging Het
Krt8 G T 15: 101,998,822 D275E probably benign Het
Lyg2 A C 1: 37,908,996 N132K probably benign Het
Lyst G A 13: 13,637,658 R885Q probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mcc C A 18: 44,475,136 G355W probably damaging Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Mrgpra3 A T 7: 47,590,094 M28K probably benign Het
Ms4a15 A G 19: 10,984,795 C47R probably benign Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo18b C T 5: 112,874,663 probably benign Het
Nat8f4 A T 6: 85,901,225 H105Q possibly damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Nrap T C 19: 56,321,962 R1534G possibly damaging Het
Nwd2 C A 5: 63,805,156 N694K probably benign Het
Oas1c G A 5: 120,803,017 A35V probably null Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr1532-ps1 A G 7: 106,914,906 K236R probably damaging Het
Olfr482 C T 7: 108,095,195 R125H possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Prex1 C T 2: 166,587,157 V839I probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Rbm20 T C 19: 53,851,741 S1054P probably benign Het
Rhox13 G C X: 38,121,344 E19Q unknown Het
Ryr2 A G 13: 11,738,216 F1740L possibly damaging Het
Sox1 C A 8: 12,396,927 N189K possibly damaging Het
Spta1 C A 1: 174,174,341 S12R possibly damaging Het
Stard13 A G 5: 151,039,731 L971P probably damaging Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Twistnb A G 12: 33,433,588 H113R probably damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Vldlr A G 19: 27,238,386 D220G probably damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Wdr25 T A 12: 108,898,174 S82T possibly damaging Het
Wdr66 C G 5: 123,283,348 probably null Het
Wnk4 C A 11: 101,275,035 P796Q probably damaging Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zc3h15 G A 2: 83,657,016 V60I probably benign Het
Zfp629 G A 7: 127,611,791 T282M probably damaging Het
Zscan22 T G 7: 12,903,960 V93G probably damaging Het
Other mutations in Tigd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01791:Tigd4 APN 3 84594745 missense probably damaging 1.00
R0080:Tigd4 UTSW 3 84594145 missense probably benign 0.19
R0320:Tigd4 UTSW 3 84595174 missense probably benign
R0347:Tigd4 UTSW 3 84593860 missense probably damaging 1.00
R1875:Tigd4 UTSW 3 84595087 missense probably benign 0.00
R1876:Tigd4 UTSW 3 84593935 nonsense probably null
R2142:Tigd4 UTSW 3 84594363 missense possibly damaging 0.95
R2519:Tigd4 UTSW 3 84593914 missense probably damaging 1.00
R2866:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R2867:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R2867:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R3974:Tigd4 UTSW 3 84595278 missense possibly damaging 0.82
R4094:Tigd4 UTSW 3 84594640 missense probably damaging 1.00
R4967:Tigd4 UTSW 3 84595153 missense probably benign 0.03
R5155:Tigd4 UTSW 3 84594663 missense possibly damaging 0.96
R5878:Tigd4 UTSW 3 84594442 missense probably benign 0.09
R6174:Tigd4 UTSW 3 84595267 missense probably benign 0.02
R6960:Tigd4 UTSW 3 84594116 missense probably damaging 1.00
R7414:Tigd4 UTSW 3 84593821 missense probably benign 0.37
R7445:Tigd4 UTSW 3 84595164 missense probably benign 0.01
X0023:Tigd4 UTSW 3 84593857 missense probably damaging 1.00
X0064:Tigd4 UTSW 3 84594478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGTGTCTAAACGTTCC -3'
(R):5'- GCAAAGGGAGCTTCTCAGAG -3'

Sequencing Primer
(F):5'- CCGATGTTGCGTCTAAAAGC -3'
(R):5'- AGAGCCATCCATATTTGTTCCGAG -3'
Posted On2014-10-16