Incidental Mutation 'R2258:Nwd2'
ID243521
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission 040258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R2258 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63805156 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 694 (N694K)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584] [ENSMUST00000162166]
Predicted Effect probably benign
Transcript: ENSMUST00000159584
AA Change: N694K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: N694K

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162166
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,618 N308S possibly damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Ang4 A G 14: 51,764,498 probably benign Het
Ap3d1 A G 10: 80,721,132 S315P probably benign Het
Arhgap15 G A 2: 44,386,347 G437R probably damaging Het
Cacna2d1 T C 5: 16,357,289 C810R probably damaging Het
Capn5 A G 7: 98,135,875 W131R probably damaging Het
Ccnj A G 19: 40,845,833 Q292R probably benign Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdk5r2 T C 1: 74,855,900 L268P probably damaging Het
Clrn2 A G 5: 45,453,962 D51G probably benign Het
Cntd1 T C 11: 101,284,856 S174P probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Col17a1 C T 19: 47,681,377 probably null Het
Cyp2a5 A G 7: 26,837,103 D169G possibly damaging Het
Cyp2c37 A G 19: 39,995,859 I264V possibly damaging Het
Cyp2j12 A G 4: 96,133,078 I97T probably damaging Het
Eif3b T C 5: 140,427,503 F354L possibly damaging Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
F5 T A 1: 164,192,181 S742T probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fam69b T C 2: 26,635,150 L157P probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fndc3b G T 3: 27,440,160 Q939K possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gm17689 C A 9: 36,581,865 V54L probably benign Het
Gm5065 A G 7: 5,359,402 M11V probably benign Het
Gm8994 A T 6: 136,328,561 M7L probably benign Het
Gpbar1 T C 1: 74,279,005 F136L probably benign Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hecw1 A T 13: 14,316,138 D756E probably benign Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Inpp4a T A 1: 37,377,696 S433T probably damaging Het
Ism2 C A 12: 87,280,074 V320L possibly damaging Het
Krt8 G T 15: 101,998,822 D275E probably benign Het
Lyg2 A C 1: 37,908,996 N132K probably benign Het
Lyst G A 13: 13,637,658 R885Q probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mcc C A 18: 44,475,136 G355W probably damaging Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Mrgpra3 A T 7: 47,590,094 M28K probably benign Het
Ms4a15 A G 19: 10,984,795 C47R probably benign Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo18b C T 5: 112,874,663 probably benign Het
Nat8f4 A T 6: 85,901,225 H105Q possibly damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Nrap T C 19: 56,321,962 R1534G possibly damaging Het
Oas1c G A 5: 120,803,017 A35V probably null Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr1532-ps1 A G 7: 106,914,906 K236R probably damaging Het
Olfr482 C T 7: 108,095,195 R125H possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Prex1 C T 2: 166,587,157 V839I probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Rbm20 T C 19: 53,851,741 S1054P probably benign Het
Rhox13 G C X: 38,121,344 E19Q unknown Het
Ryr2 A G 13: 11,738,216 F1740L possibly damaging Het
Sox1 C A 8: 12,396,927 N189K possibly damaging Het
Spta1 C A 1: 174,174,341 S12R possibly damaging Het
Stard13 A G 5: 151,039,731 L971P probably damaging Het
Tigd4 T A 3: 84,594,293 N172K probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Twistnb A G 12: 33,433,588 H113R probably damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Vldlr A G 19: 27,238,386 D220G probably damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Wdr25 T A 12: 108,898,174 S82T possibly damaging Het
Wdr66 C G 5: 123,283,348 probably null Het
Wnk4 C A 11: 101,275,035 P796Q probably damaging Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zc3h15 G A 2: 83,657,016 V60I probably benign Het
Zfp629 G A 7: 127,611,791 T282M probably damaging Het
Zscan22 T G 7: 12,903,960 V93G probably damaging Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
R7034:Nwd2 UTSW 5 63804915 missense probably damaging 1.00
R7168:Nwd2 UTSW 5 63807494 missense probably benign 0.04
R7326:Nwd2 UTSW 5 63800409 missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63807091 nonsense probably null
R7576:Nwd2 UTSW 5 63807393 missense probably benign 0.00
R7580:Nwd2 UTSW 5 63808281 missense probably benign 0.05
R7723:Nwd2 UTSW 5 63808004 missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63804504 missense probably damaging 0.99
RF020:Nwd2 UTSW 5 63805723 nonsense probably null
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGGATGTCGATGAGTCCTCC -3'
(R):5'- CAGGATTGTGTGCATCTCTCG -3'

Sequencing Primer
(F):5'- CTCTGTGTGACTGTCCACGAAAG -3'
(R):5'- TGCATCTCTCGAAGGTTGC -3'
Posted On2014-10-16