Incidental Mutation 'R2258:Muc5ac'
ID243545
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Namemucin 5, subtypes A and C, tracheobronchial/gastric
SynonymsMGM, 2210005L13Rik
MMRRC Submission 040258-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2258 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141788972-141819231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141791008 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 72 (N72S)
Ref Sequence ENSEMBL: ENSMUSP00000122353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
Predicted Effect probably benign
Transcript: ENSMUST00000041924
AA Change: N72S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: N72S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155534
AA Change: N72S

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: N72S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163321
AA Change: N72S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: N72S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,618 N308S possibly damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Ang4 A G 14: 51,764,498 probably benign Het
Ap3d1 A G 10: 80,721,132 S315P probably benign Het
Arhgap15 G A 2: 44,386,347 G437R probably damaging Het
Cacna2d1 T C 5: 16,357,289 C810R probably damaging Het
Capn5 A G 7: 98,135,875 W131R probably damaging Het
Ccnj A G 19: 40,845,833 Q292R probably benign Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdk5r2 T C 1: 74,855,900 L268P probably damaging Het
Clrn2 A G 5: 45,453,962 D51G probably benign Het
Cntd1 T C 11: 101,284,856 S174P probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Col17a1 C T 19: 47,681,377 probably null Het
Cyp2a5 A G 7: 26,837,103 D169G possibly damaging Het
Cyp2c37 A G 19: 39,995,859 I264V possibly damaging Het
Cyp2j12 A G 4: 96,133,078 I97T probably damaging Het
Eif3b T C 5: 140,427,503 F354L possibly damaging Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
F5 T A 1: 164,192,181 S742T probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fam69b T C 2: 26,635,150 L157P probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fndc3b G T 3: 27,440,160 Q939K possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gm17689 C A 9: 36,581,865 V54L probably benign Het
Gm5065 A G 7: 5,359,402 M11V probably benign Het
Gm8994 A T 6: 136,328,561 M7L probably benign Het
Gpbar1 T C 1: 74,279,005 F136L probably benign Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hecw1 A T 13: 14,316,138 D756E probably benign Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Inpp4a T A 1: 37,377,696 S433T probably damaging Het
Ism2 C A 12: 87,280,074 V320L possibly damaging Het
Krt8 G T 15: 101,998,822 D275E probably benign Het
Lyg2 A C 1: 37,908,996 N132K probably benign Het
Lyst G A 13: 13,637,658 R885Q probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mcc C A 18: 44,475,136 G355W probably damaging Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Mrgpra3 A T 7: 47,590,094 M28K probably benign Het
Ms4a15 A G 19: 10,984,795 C47R probably benign Het
Myo18b C T 5: 112,874,663 probably benign Het
Nat8f4 A T 6: 85,901,225 H105Q possibly damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Nrap T C 19: 56,321,962 R1534G possibly damaging Het
Nwd2 C A 5: 63,805,156 N694K probably benign Het
Oas1c G A 5: 120,803,017 A35V probably null Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr1532-ps1 A G 7: 106,914,906 K236R probably damaging Het
Olfr482 C T 7: 108,095,195 R125H possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Prex1 C T 2: 166,587,157 V839I probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Rbm20 T C 19: 53,851,741 S1054P probably benign Het
Rhox13 G C X: 38,121,344 E19Q unknown Het
Ryr2 A G 13: 11,738,216 F1740L possibly damaging Het
Sox1 C A 8: 12,396,927 N189K possibly damaging Het
Spta1 C A 1: 174,174,341 S12R possibly damaging Het
Stard13 A G 5: 151,039,731 L971P probably damaging Het
Tigd4 T A 3: 84,594,293 N172K probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Twistnb A G 12: 33,433,588 H113R probably damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Vldlr A G 19: 27,238,386 D220G probably damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Wdr25 T A 12: 108,898,174 S82T possibly damaging Het
Wdr66 C G 5: 123,283,348 probably null Het
Wnk4 C A 11: 101,275,035 P796Q probably damaging Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zc3h15 G A 2: 83,657,016 V60I probably benign Het
Zfp629 G A 7: 127,611,791 T282M probably damaging Het
Zscan22 T G 7: 12,903,960 V93G probably damaging Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141812703 missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141807473 missense probably benign 0.12
IGL01155:Muc5ac APN 7 141806943 splice site probably benign
IGL01452:Muc5ac APN 7 141817555 missense probably benign 0.00
IGL01590:Muc5ac APN 7 141798893 missense probably benign 0.02
IGL02104:Muc5ac APN 7 141811078 missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141800177 missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141818800 nonsense probably null
IGL02178:Muc5ac APN 7 141805447 splice site probably benign
IGL02403:Muc5ac APN 7 141803450 missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141817044 missense probably benign 0.01
IGL02665:Muc5ac APN 7 141791086 missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141795263 missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141805775 missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141813781 missense probably benign 0.34
IGL03384:Muc5ac APN 7 141812403 missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141795213 missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141807416 missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141818630 missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141795275 missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141811039 missense probably benign 0.08
R0363:Muc5ac UTSW 7 141800960 missense probably benign 0.01
R0384:Muc5ac UTSW 7 141812251 missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141792034 nonsense probably null
R0583:Muc5ac UTSW 7 141807608 missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141796244 missense probably benign 0.02
R0682:Muc5ac UTSW 7 141805669 missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141807709 missense probably benign 0.03
R0883:Muc5ac UTSW 7 141796265 missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141807515 missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141816929 missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141807323 missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141807377 missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141813892 splice site probably null
R1599:Muc5ac UTSW 7 141798903 missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141801531 missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141807086 missense probably benign 0.00
R1911:Muc5ac UTSW 7 141796304 missense probably benign 0.18
R1922:Muc5ac UTSW 7 141793689 missense probably benign 0.03
R1966:Muc5ac UTSW 7 141803376 missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141813152 missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141792035 missense probably benign 0.01
R2126:Muc5ac UTSW 7 141810742 missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141812347 missense possibly damaging 0.93
R2259:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2293:Muc5ac UTSW 7 141807199 missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141818104 missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141791140 missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141807641 missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141792736 splice site probably null
R3762:Muc5ac UTSW 7 141807475 missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141798501 missense probably benign 0.32
R3806:Muc5ac UTSW 7 141813734 missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141814723 missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141791224 missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141802892 missense probably benign
R3981:Muc5ac UTSW 7 141813775 missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141799844 critical splice donor site probably null
R4043:Muc5ac UTSW 7 141807478 missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141811130 missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141802835 missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141817110 missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141791103 missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141789763 missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141817601 missense probably benign 0.00
R4789:Muc5ac UTSW 7 141798882 missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141817902 nonsense probably null
R4971:Muc5ac UTSW 7 141816278 missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141809456 intron probably benign
R5088:Muc5ac UTSW 7 141796319 missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141814742 missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141793971 missense probably benign 0.32
R5366:Muc5ac UTSW 7 141807550 missense probably benign 0.01
R5497:Muc5ac UTSW 7 141807643 missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141807832 missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141793715 critical splice donor site probably null
R5811:Muc5ac UTSW 7 141798984 missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141817907 missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141790669 nonsense probably null
R5977:Muc5ac UTSW 7 141796367 missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141811857 missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141801232 missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141815586 missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141789795 missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141816864 nonsense probably null
R6341:Muc5ac UTSW 7 141801492 missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141812679 missense probably benign 0.05
R6481:Muc5ac UTSW 7 141809071 intron probably benign
R6483:Muc5ac UTSW 7 141802854 missense probably benign 0.18
R6627:Muc5ac UTSW 7 141808690 intron probably benign
R6636:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141803328 missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141798992 missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141809552 intron probably benign
R6844:Muc5ac UTSW 7 141809744 intron probably benign
R6847:Muc5ac UTSW 7 141809744 intron probably benign
R6852:Muc5ac UTSW 7 141816907 missense probably benign 0.03
R6862:Muc5ac UTSW 7 141809744 intron probably benign
R6863:Muc5ac UTSW 7 141809744 intron probably benign
R6864:Muc5ac UTSW 7 141809744 intron probably benign
R6865:Muc5ac UTSW 7 141809744 intron probably benign
R6874:Muc5ac UTSW 7 141809744 intron probably benign
R6875:Muc5ac UTSW 7 141809744 intron probably benign
R6876:Muc5ac UTSW 7 141809744 intron probably benign
R6877:Muc5ac UTSW 7 141809744 intron probably benign
R6889:Muc5ac UTSW 7 141809744 intron probably benign
R6920:Muc5ac UTSW 7 141793298 missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141818714 missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141809687 intron probably benign
R7091:Muc5ac UTSW 7 141809687 intron probably benign
R7092:Muc5ac UTSW 7 141809648 intron probably benign
R7092:Muc5ac UTSW 7 141809687 intron probably benign
R7110:Muc5ac UTSW 7 141799822 missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141813822 nonsense probably null
R7238:Muc5ac UTSW 7 141809517 missense unknown
R7238:Muc5ac UTSW 7 141809687 intron probably benign
R7396:Muc5ac UTSW 7 141808415 missense unknown
R7456:Muc5ac UTSW 7 141793167 missense probably benign 0.32
R7477:Muc5ac UTSW 7 141816282 missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141813799 missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141808668 missense unknown
R7604:Muc5ac UTSW 7 141809709 missense unknown
R7635:Muc5ac UTSW 7 141805676 missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141805753 missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141809422 missense unknown
R7651:Muc5ac UTSW 7 141796254 missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141809383 missense unknown
R7720:Muc5ac UTSW 7 141809303 missense unknown
R7749:Muc5ac UTSW 7 141809303 missense unknown
R7750:Muc5ac UTSW 7 141809303 missense unknown
R7751:Muc5ac UTSW 7 141809303 missense unknown
R7754:Muc5ac UTSW 7 141809303 missense unknown
R7798:Muc5ac UTSW 7 141794041 critical splice donor site probably null
R7835:Muc5ac UTSW 7 141809303 missense unknown
R7837:Muc5ac UTSW 7 141815963 missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141803429 missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141795852 missense probably benign 0.00
R7874:Muc5ac UTSW 7 141809303 missense unknown
R7876:Muc5ac UTSW 7 141809303 missense unknown
R7877:Muc5ac UTSW 7 141809303 missense unknown
R7881:Muc5ac UTSW 7 141809303 missense unknown
R7884:Muc5ac UTSW 7 141809303 missense unknown
R7921:Muc5ac UTSW 7 141809687 intron probably benign
R7976:Muc5ac UTSW 7 141809791 missense unknown
R8104:Muc5ac UTSW 7 141804783 missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141807331 missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141802948 missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141809263 missense unknown
R8386:Muc5ac UTSW 7 141807634 missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141810476 missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141807155 missense probably damaging 1.00
X0060:Muc5ac UTSW 7 141803333 missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141809744 intron probably benign
Z1088:Muc5ac UTSW 7 141811692 missense possibly damaging 0.86
Z1177:Muc5ac UTSW 7 141809224 missense unknown
Z1177:Muc5ac UTSW 7 141818040 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TATCCAAAGCTGCTGCGAGC -3'
(R):5'- TCATGGTGACCCTACTCAGAG -3'

Sequencing Primer
(F):5'- GGTTCCAGGGCTTCCTAAGTCAG -3'
(R):5'- CCCTACTCAGAGTGGTGGTATTAGAC -3'
Posted On2014-10-16