Incidental Mutation 'R2258:Marveld2'
ID243575
Institutional Source Beutler Lab
Gene Symbol Marveld2
Ensembl Gene ENSMUSG00000021636
Gene NameMARVEL (membrane-associating) domain containing 2
SynonymsTric-b, Tricellulin, Tric, Mrvldc2, Tric-c, Tric-a
MMRRC Submission 040258-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2258 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100595957-100616971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100612470 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 34 (S34P)
Ref Sequence ENSEMBL: ENSMUSP00000153294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022136] [ENSMUST00000022137] [ENSMUST00000163163] [ENSMUST00000168772] [ENSMUST00000225754] [ENSMUST00000226050]
Predicted Effect probably benign
Transcript: ENSMUST00000022136
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022137
AA Change: S34P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022137
Gene: ENSMUSG00000021636
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 4.1e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 2.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163163
SMART Domains Protein: ENSMUSP00000129990
Gene: ENSMUSG00000021636

DomainStartEndE-ValueType
low complexity region 25 53 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
Pfam:Occludin_ELL 166 268 4.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168772
AA Change: S34P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126438
Gene: ENSMUSG00000021636
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 3.6e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 6.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225754
AA Change: S34P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000226050
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein found at the tight junctions between epithelial cells. The encoded protein helps establish epithelial barriers such as those in the organ of Corti, where these barriers are required for normal hearing. Defects in this gene are a cause of deafness autosomal recessive type 49 (DFNB49). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-in mutation fisplay syndromic deafness with rapid progressive degeneration of the hair cells, increased body and organ weights and abnormal tricellular tight junctions. However, vestibular function is intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,618 N308S possibly damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Ang4 A G 14: 51,764,498 probably benign Het
Ap3d1 A G 10: 80,721,132 S315P probably benign Het
Arhgap15 G A 2: 44,386,347 G437R probably damaging Het
Cacna2d1 T C 5: 16,357,289 C810R probably damaging Het
Capn5 A G 7: 98,135,875 W131R probably damaging Het
Ccnj A G 19: 40,845,833 Q292R probably benign Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdk5r2 T C 1: 74,855,900 L268P probably damaging Het
Clrn2 A G 5: 45,453,962 D51G probably benign Het
Cntd1 T C 11: 101,284,856 S174P probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Col17a1 C T 19: 47,681,377 probably null Het
Cyp2a5 A G 7: 26,837,103 D169G possibly damaging Het
Cyp2c37 A G 19: 39,995,859 I264V possibly damaging Het
Cyp2j12 A G 4: 96,133,078 I97T probably damaging Het
Eif3b T C 5: 140,427,503 F354L possibly damaging Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
F5 T A 1: 164,192,181 S742T probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fam69b T C 2: 26,635,150 L157P probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fndc3b G T 3: 27,440,160 Q939K possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gm17689 C A 9: 36,581,865 V54L probably benign Het
Gm5065 A G 7: 5,359,402 M11V probably benign Het
Gm8994 A T 6: 136,328,561 M7L probably benign Het
Gpbar1 T C 1: 74,279,005 F136L probably benign Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hecw1 A T 13: 14,316,138 D756E probably benign Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Inpp4a T A 1: 37,377,696 S433T probably damaging Het
Ism2 C A 12: 87,280,074 V320L possibly damaging Het
Krt8 G T 15: 101,998,822 D275E probably benign Het
Lyg2 A C 1: 37,908,996 N132K probably benign Het
Lyst G A 13: 13,637,658 R885Q probably benign Het
Mcc C A 18: 44,475,136 G355W probably damaging Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Mrgpra3 A T 7: 47,590,094 M28K probably benign Het
Ms4a15 A G 19: 10,984,795 C47R probably benign Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo18b C T 5: 112,874,663 probably benign Het
Nat8f4 A T 6: 85,901,225 H105Q possibly damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Nrap T C 19: 56,321,962 R1534G possibly damaging Het
Nwd2 C A 5: 63,805,156 N694K probably benign Het
Oas1c G A 5: 120,803,017 A35V probably null Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr1532-ps1 A G 7: 106,914,906 K236R probably damaging Het
Olfr482 C T 7: 108,095,195 R125H possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Prex1 C T 2: 166,587,157 V839I probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Rbm20 T C 19: 53,851,741 S1054P probably benign Het
Rhox13 G C X: 38,121,344 E19Q unknown Het
Ryr2 A G 13: 11,738,216 F1740L possibly damaging Het
Sox1 C A 8: 12,396,927 N189K possibly damaging Het
Spta1 C A 1: 174,174,341 S12R possibly damaging Het
Stard13 A G 5: 151,039,731 L971P probably damaging Het
Tigd4 T A 3: 84,594,293 N172K probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Twistnb A G 12: 33,433,588 H113R probably damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Vldlr A G 19: 27,238,386 D220G probably damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Wdr25 T A 12: 108,898,174 S82T possibly damaging Het
Wdr66 C G 5: 123,283,348 probably null Het
Wnk4 C A 11: 101,275,035 P796Q probably damaging Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zc3h15 G A 2: 83,657,016 V60I probably benign Het
Zfp629 G A 7: 127,611,791 T282M probably damaging Het
Zscan22 T G 7: 12,903,960 V93G probably damaging Het
Other mutations in Marveld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Marveld2 APN 13 100600893 missense possibly damaging 0.83
IGL00573:Marveld2 APN 13 100597859 splice site probably benign
R1569:Marveld2 UTSW 13 100600998 missense probably benign 0.32
R1884:Marveld2 UTSW 13 100600621 missense probably benign 0.15
R1958:Marveld2 UTSW 13 100597350 missense probably damaging 1.00
R2249:Marveld2 UTSW 13 100612091 missense probably benign
R2259:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2260:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2473:Marveld2 UTSW 13 100597321 missense probably damaging 0.98
R3918:Marveld2 UTSW 13 100611893 missense probably benign 0.01
R4010:Marveld2 UTSW 13 100611428 splice site probably null
R4089:Marveld2 UTSW 13 100600480 missense probably benign 0.04
R4634:Marveld2 UTSW 13 100611939 missense probably damaging 1.00
R4775:Marveld2 UTSW 13 100616795 unclassified probably benign
R4961:Marveld2 UTSW 13 100611923 missense probably benign 0.12
R5424:Marveld2 UTSW 13 100612187 missense probably benign
R5546:Marveld2 UTSW 13 100600938 missense probably benign 0.14
R5900:Marveld2 UTSW 13 100611668 missense probably damaging 1.00
R5977:Marveld2 UTSW 13 100611689 missense possibly damaging 0.87
R6177:Marveld2 UTSW 13 100597378 missense probably damaging 0.99
R7409:Marveld2 UTSW 13 100611476 missense probably damaging 0.99
R7484:Marveld2 UTSW 13 100611560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATCAGACACCGGGTTATCC -3'
(R):5'- TTGCCGCCTGAATACGTTTTG -3'

Sequencing Primer
(F):5'- TTCCCTCTGAAGAAATTTTTCCAGG -3'
(R):5'- CCGCCTGAATACGTTTTGTAATTAAG -3'
Posted On2014-10-16