Mutagenetix > Incidental Mutations

Incidental Mutation 'R2258:Krt8'

243578

Institutional Source

Beutler Lab

Gene Symbol

Krt8

Ensembl Gene

ENSMUSG00000049382

Gene Name

keratin 8

Synonyms

Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2

MMRRC Submission

040258-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2258 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101996698-102004482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 101998822 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 275 (D275E)

Ref Sequence

ENSEMBL: ENSMUSP00000023952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023952]

AlphaFold

P11679

Predicted Effect

probably benign
Transcript: ENSMUST00000023952
AA Change: D275E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: D275E

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	1	93	9.4e-18	PFAM
Filament	96	407	7.82e-188	SMART
low complexity region	421	438	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,413,618	N308S	possibly damaging	Het
Acot5	A	T	12: 84,075,869	H409L	possibly damaging	Het
Ang4	A	G	14: 51,764,498		probably benign	Het
Ap3d1	A	G	10: 80,721,132	S315P	probably benign	Het
Arhgap15	G	A	2: 44,386,347	G437R	probably damaging	Het
Cacna2d1	T	C	5: 16,357,289	C810R	probably damaging	Het
Capn5	A	G	7: 98,135,875	W131R	probably damaging	Het
Ccnj	A	G	19: 40,845,833	Q292R	probably benign	Het
Cd177	A	G	7: 24,756,236	V287A	possibly damaging	Het
Cdk5r2	T	C	1: 74,855,900	L268P	probably damaging	Het
Clrn2	A	G	5: 45,453,962	D51G	probably benign	Het
Cntd1	T	C	11: 101,284,856	S174P	probably damaging	Het
Col11a2	A	G	17: 34,039,677	H8R	probably benign	Het
Col17a1	C	T	19: 47,681,377		probably null	Het
Cyp2a5	A	G	7: 26,837,103	D169G	possibly damaging	Het
Cyp2c37	A	G	19: 39,995,859	I264V	possibly damaging	Het
Cyp2j12	A	G	4: 96,133,078	I97T	probably damaging	Het
Eif3b	T	C	5: 140,427,503	F354L	possibly damaging	Het
Entpd2	C	T	2: 25,398,087	P108S	probably damaging	Het
F5	T	A	1: 164,192,181	S742T	probably damaging	Het
Fam187a	A	G	11: 102,885,298		probably benign	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Fam69b	T	C	2: 26,635,150	L157P	probably damaging	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fndc3b	G	T	3: 27,440,160	Q939K	possibly damaging	Het
Gja4	C	A	4: 127,312,830	D47Y	probably damaging	Het
Gm11565	T	G	11: 99,915,018	C79G	possibly damaging	Het
Gm17689	C	A	9: 36,581,865	V54L	probably benign	Het
Gm5065	A	G	7: 5,359,402	M11V	probably benign	Het
Gm8994	A	T	6: 136,328,561	M7L	probably benign	Het
Gpbar1	T	C	1: 74,279,005	F136L	probably benign	Het
Gsn	G	A	2: 35,290,337	G130E	probably damaging	Het
Hecw1	A	T	13: 14,316,138	D756E	probably benign	Het
Hrasls5	C	T	19: 7,612,746	R46C	probably damaging	Het
Hrc	C	A	7: 45,336,681	R419S	possibly damaging	Het
Inpp4a	T	A	1: 37,377,696	S433T	probably damaging	Het
Ism2	C	A	12: 87,280,074	V320L	possibly damaging	Het
Lyg2	A	C	1: 37,908,996	N132K	probably benign	Het
Lyst	G	A	13: 13,637,658	R885Q	probably benign	Het
Marveld2	A	G	13: 100,612,470	S34P	probably benign	Het
Mcc	C	A	18: 44,475,136	G355W	probably damaging	Het
Mettl7a1	A	T	15: 100,313,168	I174F	probably benign	Het
Mllt6	T	C	11: 97,664,976	V44A	probably damaging	Het
Mrgpra3	A	T	7: 47,590,094	M28K	probably benign	Het
Ms4a15	A	G	19: 10,984,795	C47R	probably benign	Het
Muc5ac	A	G	7: 141,791,008	N72S	probably benign	Het
Myo18b	C	T	5: 112,874,663		probably benign	Het
Nat8f4	A	T	6: 85,901,225	H105Q	possibly damaging	Het
Ncapd3	A	G	9: 27,056,072	D568G	probably benign	Het
Nptx1	T	G	11: 119,543,316	I315L	probably benign	Het
Nrap	T	C	19: 56,321,962	R1534G	possibly damaging	Het
Nwd2	C	A	5: 63,805,156	N694K	probably benign	Het
Oas1c	G	A	5: 120,803,017	A35V	probably null	Het
Olfr1350	A	T	7: 6,570,023	I11F	probably damaging	Het
Olfr1532-ps1	A	G	7: 106,914,906	K236R	probably damaging	Het
Olfr482	C	T	7: 108,095,195	R125H	possibly damaging	Het
Olfr933	T	C	9: 38,976,000	V108A	probably benign	Het
Pde2a	A	T	7: 101,484,567	D85V	probably damaging	Het
Prex1	C	T	2: 166,587,157	V839I	probably benign	Het
Psmd3	T	A	11: 98,690,964	M305K	probably benign	Het
Rbm20	T	C	19: 53,851,741	S1054P	probably benign	Het
Rhox13	G	C	X: 38,121,344	E19Q	unknown	Het
Ryr2	A	G	13: 11,738,216	F1740L	possibly damaging	Het
Sox1	C	A	8: 12,396,927	N189K	possibly damaging	Het
Spta1	C	A	1: 174,174,341	S12R	possibly damaging	Het
Stard13	A	G	5: 151,039,731	L971P	probably damaging	Het
Tigd4	T	A	3: 84,594,293	N172K	probably benign	Het
Ttyh1	T	C	7: 4,128,184	V218A	probably damaging	Het
Twistnb	A	G	12: 33,433,588	H113R	probably damaging	Het
Unc45b	T	A	11: 82,917,799	M237K	probably benign	Het
Vldlr	A	G	19: 27,238,386	D220G	probably damaging	Het
Vps13c	A	G	9: 67,953,860	N2891S	probably benign	Het
Wdr25	T	A	12: 108,898,174	S82T	possibly damaging	Het
Wdr66	C	G	5: 123,283,348		probably null	Het
Wnk4	C	A	11: 101,275,035	P796Q	probably damaging	Het
Xpo5	C	T	17: 46,240,896	Q1050*	probably null	Het
Zc3h15	G	A	2: 83,657,016	V60I	probably benign	Het
Zfp629	G	A	7: 127,611,791	T282M	probably damaging	Het
Zscan22	T	G	7: 12,903,960	V93G	probably damaging	Het

Other mutations in Krt8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Krt8	APN	15	101998025	missense	probably benign
IGL01643:Krt8	APN	15	101997073	missense	possibly damaging	0.64
IGL01966:Krt8	APN	15	101997670	missense	probably benign	0.08
IGL02587:Krt8	APN	15	101998932	missense	probably benign	0.04
IGL03088:Krt8	APN	15	102000587	missense	possibly damaging	0.90
R0531:Krt8	UTSW	15	102001448	missense	probably benign	0.12
R1451:Krt8	UTSW	15	101998829	missense	possibly damaging	0.93
R2348:Krt8	UTSW	15	101998865	missense	probably benign	0.31
R2566:Krt8	UTSW	15	101998024	missense	probably benign	0.03
R3796:Krt8	UTSW	15	101999442	missense	probably benign	0.00
R4834:Krt8	UTSW	15	101998821	missense	probably damaging	1.00
R4965:Krt8	UTSW	15	101996951	missense	probably benign
R5212:Krt8	UTSW	15	101997967	missense	possibly damaging	0.52
R5249:Krt8	UTSW	15	101998440	missense	possibly damaging	0.69
R5419:Krt8	UTSW	15	102003902	missense	probably damaging	0.98
R5778:Krt8	UTSW	15	102003939	missense	probably damaging	0.99
R5997:Krt8	UTSW	15	102000594	missense	possibly damaging	0.77
R6503:Krt8	UTSW	15	101997934	missense	possibly damaging	0.66
R6683:Krt8	UTSW	15	101998004	missense	probably benign
R6812:Krt8	UTSW	15	101997979	missense	probably damaging	0.99
R6824:Krt8	UTSW	15	101998440	missense	possibly damaging	0.50
R6875:Krt8	UTSW	15	101997908	missense	probably benign	0.44
R7650:Krt8	UTSW	15	102004163	missense	probably benign	0.07
R8047:Krt8	UTSW	15	102003971	missense	probably damaging	0.99
R8559:Krt8	UTSW	15	102001544	missense	probably benign	0.03
R8826:Krt8	UTSW	15	102001435	missense	possibly damaging	0.89
R9146:Krt8	UTSW	15	101998935	missense	probably damaging	0.98
Z1177:Krt8	UTSW	15	101999435	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGTTCAGCTGACATCTCAC -3'
(R):5'- TCAGGTTGCAAAGGGTCCTG -3'

Sequencing Primer
(F):5'- AGTGAAGGCCCCTTTCCAGAC -3'
(R):5'- TTGCAAAGGGTCCTGTGAAC -3'

Posted On

2014-10-16