Mutagenetix > Incidental Mutation

Incidental Mutation 'R2259:Plch1'

243609

Institutional Source

Beutler Lab

Gene Symbol

Plch1

Ensembl Gene

ENSMUSG00000036834

Gene Name

phospholipase C, eta 1

Synonyms

PLCeta1, Plcl3

MMRRC Submission

040259-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.345) question?

Stock #

R2259 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63696234-63899472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63697977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 1493 (Q1493L)

Ref Sequence

ENSEMBL: ENSMUSP00000135424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]

AlphaFold

Q4KWH5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048134
AA Change: Q1463L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: Q1463L

Domain	Start	End	E-Value	Type
PH	3	112	2.37e-6	SMART
EFh	128	156	2.41e-4	SMART
EFh	164	193	1.54e-2	SMART
Pfam:EF-hand_like	198	280	2.2e-26	PFAM
PLCXc	281	426	3.13e-71	SMART
low complexity region	440	453	N/A	INTRINSIC
low complexity region	564	581	N/A	INTRINSIC
PLCYc	583	696	3.4e-49	SMART
C2	715	823	5.47e-22	SMART
low complexity region	979	997	N/A	INTRINSIC
low complexity region	1079	1091	N/A	INTRINSIC
low complexity region	1420	1435	N/A	INTRINSIC
low complexity region	1543	1557	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059973
AA Change: Q1501L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: Q1501L

Domain	Start	End	E-Value	Type
PH	21	130	1.1e-8	SMART
EFh	146	174	1.1e-6	SMART
EFh	182	211	7.6e-5	SMART
Pfam:EF-hand_like	216	298	4.5e-24	PFAM
PLCXc	299	444	1.6e-73	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	1.7e-51	SMART
C2	733	841	3.7e-24	SMART
low complexity region	1017	1035	N/A	INTRINSIC
low complexity region	1117	1129	N/A	INTRINSIC
low complexity region	1458	1473	N/A	INTRINSIC
low complexity region	1581	1595	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084105
AA Change: Q1502L

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: Q1502L

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	2.4e-27	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART
low complexity region	1018	1036	N/A	INTRINSIC
low complexity region	1118	1130	N/A	INTRINSIC
low complexity region	1459	1474	N/A	INTRINSIC
low complexity region	1582	1596	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159374

Predicted Effect

probably benign
Transcript: ENSMUST00000159676

SMART Domains

Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.8e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159982

Predicted Effect

probably benign
Transcript: ENSMUST00000160638

SMART Domains

Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	5.3e-28	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162269

SMART Domains

Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.7e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175947

SMART Domains

Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.2e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	3.4e-49	SMART
C2	733	841	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176861

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177143
AA Change: Q1493L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: Q1493L

Domain	Start	End	E-Value	Type
PH	33	142	2.37e-6	SMART
EFh	158	186	2.41e-4	SMART
EFh	194	223	1.54e-2	SMART
Pfam:EF-hand_like	228	310	2.3e-26	PFAM
PLCXc	311	456	3.13e-71	SMART
low complexity region	470	483	N/A	INTRINSIC
low complexity region	594	611	N/A	INTRINSIC
PLCYc	613	726	3.4e-49	SMART
C2	745	853	5.47e-22	SMART
low complexity region	1009	1027	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1450	1465	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrd1	T	G	5: 129,112,311	S91A	possibly damaging	Het
Ankrd13b	T	G	11: 77,476,342	N247T	probably damaging	Het
Atp10b	A	G	11: 43,172,745	D169G	probably damaging	Het
Atp10b	G	A	11: 43,189,613	V239M	probably damaging	Het
Cflar	C	T	1: 58,729,121	T121I	probably benign	Het
Clca3b	T	C	3: 144,846,381	N180D	possibly damaging	Het
Cnbd2	T	A	2: 156,335,272	I62N	probably damaging	Het
Col11a2	A	G	17: 34,039,677	H8R	probably benign	Het
Cyp2a4	C	T	7: 26,309,035	L201F	probably damaging	Het
D630003M21Rik	A	T	2: 158,204,711	L782Q	probably damaging	Het
Dctn1	C	A	6: 83,197,586	H1065N	possibly damaging	Het
Dgcr2	A	T	16: 17,844,977		probably null	Het
Dlg4	T	C	11: 70,031,370	I143T	probably damaging	Het
E2f7	T	G	10: 110,746,343	N4K	probably damaging	Het
Eef2kmt	C	T	16: 5,245,308	V323I	probably benign	Het
Eif2ak4	A	C	2: 118,455,783	I1017L	probably damaging	Het
Eln	C	A	5: 134,729,654	A126S	unknown	Het
Exoc7	T	C	11: 116,306,411	S35G	probably damaging	Het
Fam187a	A	G	11: 102,885,298		probably benign	Het
Fam196a	T	A	7: 134,917,667	E378V	probably damaging	Het
Fkbp6	C	T	5: 135,337,614		probably null	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fmn2	T	A	1: 174,502,932	L296H	unknown	Het
Galnt14	C	A	17: 73,494,266	M520I	probably benign	Het
Gba2	A	G	4: 43,570,107	C396R	probably benign	Het
Gigyf1	C	A	5: 137,520,332	A215E	possibly damaging	Het
Glb1	C	T	9: 114,443,032	Q246*	probably null	Het
Gm11565	T	G	11: 99,915,018	C79G	possibly damaging	Het
Gpr160	A	G	3: 30,896,295	Y172C	probably damaging	Het
Ift52	A	G	2: 163,028,093	N159S	probably benign	Het
Insrr	A	G	3: 87,800,452	D67G	probably damaging	Het
Irf2	A	G	8: 46,837,833	Y230C	probably benign	Het
Jmjd6	T	C	11: 116,841,314	H187R	probably damaging	Het
Kdm2b	C	T	5: 122,882,416	G90S	probably damaging	Het
Kif7	C	T	7: 79,711,589	G118D	probably damaging	Het
Klhl38	G	C	15: 58,314,978	T532S	possibly damaging	Het
Kmt2a	G	T	9: 44,881,142		probably benign	Het
Lama2	A	G	10: 27,031,127	L2346S	probably benign	Het
Marveld2	A	G	13: 100,612,470	S34P	probably benign	Het
Mettl7a1	A	T	15: 100,313,168	I174F	probably benign	Het
Mllt6	T	C	11: 97,664,976	V44A	probably damaging	Het
Muc5ac	A	G	7: 141,791,008	N72S	probably benign	Het
Myo7a	T	G	7: 98,069,499	D1388A	probably damaging	Het
Ncapd3	A	G	9: 27,056,072	D568G	probably benign	Het
Ncoa1	A	C	12: 4,315,819	H82Q	probably damaging	Het
Npbwr1	C	A	1: 5,916,658	L212F	probably damaging	Het
Nptx1	T	G	11: 119,543,316	I315L	probably benign	Het
Npy2r	G	T	3: 82,541,354	P38Q	possibly damaging	Het
Ocln	A	T	13: 100,535,029	D24E	probably damaging	Het
Olfr1350	A	T	7: 6,570,023	I11F	probably damaging	Het
Olfr295	T	A	7: 86,585,884	V203D	possibly damaging	Het
Olfr933	T	C	9: 38,976,000	V108A	probably benign	Het
Pde2a	A	T	7: 101,484,567	D85V	probably damaging	Het
Phf3	A	G	1: 30,804,343	V1845A	probably benign	Het
Pold1	T	C	7: 44,541,484		probably benign	Het
Polq	T	C	16: 37,062,097	V1541A	probably benign	Het
Psmd3	T	A	11: 98,690,964	M305K	probably benign	Het
Pura	T	C	18: 36,287,750	F197L	possibly damaging	Het
Rab3gap2	T	A	1: 185,221,859	W43R	probably damaging	Het
Repin1	A	G	6: 48,596,530	Q128R	probably benign	Het
Rnf208	G	A	2: 25,243,644	V117I	probably damaging	Het
Rpe65	A	G	3: 159,615,571	Y340C	probably damaging	Het
Ryr1	C	A	7: 29,019,741	V4414L	unknown	Het
Sephs2	T	C	7: 127,273,477	E148G	possibly damaging	Het
Spns2	T	A	11: 72,457,268	Q291L	probably benign	Het
Ssc5d	C	T	7: 4,943,916	P1090S	probably benign	Het
Tasp1	A	T	2: 139,951,506	V250D	probably damaging	Het
Tcaf3	A	G	6: 42,591,430	I664T	possibly damaging	Het
Tg	T	C	15: 66,683,898	V813A	probably benign	Het
Tmem132c	T	C	5: 127,504,924	L401P	probably benign	Het
Tmem138	T	C	19: 10,571,603	N101S	probably benign	Het
Tmem242	G	T	17: 5,433,470	A99E	probably damaging	Het
Tmem30a	C	T	9: 79,774,164	R277H	probably benign	Het
Tnni3	T	A	7: 4,519,406	I182F	probably benign	Het
Trim30a	T	A	7: 104,411,504	D355V	probably damaging	Het
Trim35	C	T	14: 66,309,262	R493*	probably null	Het
Trip10	G	C	17: 57,255,135	V254L	probably benign	Het
Tshz2	A	T	2: 169,886,406	Q505L	probably benign	Het
Ttyh1	T	C	7: 4,128,184	V218A	probably damaging	Het
Unc13b	A	T	4: 43,182,780	E3163V	possibly damaging	Het
Unc45b	T	A	11: 82,917,799	M237K	probably benign	Het
Usp8	A	G	2: 126,758,568	T1080A	probably benign	Het
Vmn2r65	T	A	7: 84,940,911	H599L	possibly damaging	Het
Vps13c	A	G	9: 67,953,860	N2891S	probably benign	Het
Xpo5	C	T	17: 46,240,896	Q1050*	probably null	Het
Zfp407	G	T	18: 84,209,793	T1897K	probably damaging	Het
Zzef1	C	T	11: 72,900,633	R2188*	probably null	Het

Other mutations in Plch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01397:Plch1	APN	3	63731729	splice site	probably null
IGL01542:Plch1	APN	3	63731649	missense	probably damaging	0.99
IGL01999:Plch1	APN	3	63753307	missense	probably damaging	1.00
IGL02153:Plch1	APN	3	63781351	missense	probably damaging	1.00
IGL02203:Plch1	APN	3	63698739	missense	possibly damaging	0.46
IGL02220:Plch1	APN	3	63698961	missense	probably damaging	0.97
IGL02259:Plch1	APN	3	63722749	critical splice donor site	probably null
IGL02268:Plch1	APN	3	63699283	makesense	probably null
IGL02411:Plch1	APN	3	63697756	splice site	probably null
IGL02472:Plch1	APN	3	63701849	missense	probably damaging	1.00
IGL02477:Plch1	APN	3	63753293	missense	probably damaging	1.00
IGL02503:Plch1	APN	3	63697864	missense	probably damaging	1.00
IGL02800:Plch1	APN	3	63698478	missense	probably benign	0.21
IGL03167:Plch1	APN	3	63722744	splice site	probably benign
IGL03182:Plch1	APN	3	63702594	nonsense	probably null
IGL03197:Plch1	APN	3	63753170	missense	probably damaging	1.00
IGL03251:Plch1	APN	3	63784002	missense	possibly damaging	0.93
BB009:Plch1	UTSW	3	63701981	missense	probably benign	0.05
BB019:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R0335:Plch1	UTSW	3	63710978	missense	probably damaging	1.00
R0347:Plch1	UTSW	3	63753316	missense	probably damaging	1.00
R0631:Plch1	UTSW	3	63699219	missense	probably benign	0.23
R0687:Plch1	UTSW	3	63716029	missense	probably damaging	1.00
R0738:Plch1	UTSW	3	63702553	intron	probably benign
R0883:Plch1	UTSW	3	63753256	missense	probably damaging	1.00
R1437:Plch1	UTSW	3	63697533	missense	probably benign	0.37
R1678:Plch1	UTSW	3	63740694	missense	probably damaging	1.00
R1738:Plch1	UTSW	3	63719238	missense	probably benign	0.12
R1929:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R1955:Plch1	UTSW	3	63755267	missense	probably damaging	0.98
R2078:Plch1	UTSW	3	63701943	missense	probably benign	0.01
R2112:Plch1	UTSW	3	63722806	missense	probably damaging	1.00
R2158:Plch1	UTSW	3	63721234	missense	probably benign	0.00
R2165:Plch1	UTSW	3	63698482	missense	probably benign	0.01
R2271:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R3110:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3112:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3407:Plch1	UTSW	3	63699347	unclassified	probably benign
R3408:Plch1	UTSW	3	63699347	unclassified	probably benign
R3791:Plch1	UTSW	3	63699523	missense	probably benign
R3793:Plch1	UTSW	3	63697831	missense	probably damaging	0.96
R3928:Plch1	UTSW	3	63767623	missense	probably damaging	1.00
R4211:Plch1	UTSW	3	63711219	missense	probably damaging	1.00
R4212:Plch1	UTSW	3	63870759	start gained	probably benign
R4223:Plch1	UTSW	3	63701900	missense	probably damaging	1.00
R4491:Plch1	UTSW	3	63740739	missense	probably damaging	1.00
R4589:Plch1	UTSW	3	63781507	missense	probably damaging	1.00
R4656:Plch1	UTSW	3	63704177	missense	probably damaging	1.00
R4701:Plch1	UTSW	3	63699496	splice site	probably null
R4716:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R4772:Plch1	UTSW	3	63753325	missense	probably damaging	1.00
R4902:Plch1	UTSW	3	63740843	intron	probably benign
R5058:Plch1	UTSW	3	63722781	missense	probably damaging	1.00
R5092:Plch1	UTSW	3	63698710	missense	probably benign	0.02
R5093:Plch1	UTSW	3	63773715	missense	probably damaging	0.99
R5210:Plch1	UTSW	3	63699778	critical splice donor site	probably null
R5368:Plch1	UTSW	3	63701973	missense	possibly damaging	0.82
R5373:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5374:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5501:Plch1	UTSW	3	63707741	missense	probably damaging	1.00
R5606:Plch1	UTSW	3	63740687	missense	probably benign	0.35
R5738:Plch1	UTSW	3	63773655	missense	probably damaging	1.00
R5835:Plch1	UTSW	3	63697522	missense	probably benign
R6106:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6107:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6108:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6110:Plch1	UTSW	3	63698858	missense	possibly damaging	0.62
R6116:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6147:Plch1	UTSW	3	63722881	missense	probably damaging	1.00
R6195:Plch1	UTSW	3	63740789	missense	probably damaging	1.00
R6315:Plch1	UTSW	3	63781390	nonsense	probably null
R6316:Plch1	UTSW	3	63781390	nonsense	probably null
R6317:Plch1	UTSW	3	63781390	nonsense	probably null
R6318:Plch1	UTSW	3	63781390	nonsense	probably null
R6324:Plch1	UTSW	3	63781390	nonsense	probably null
R6325:Plch1	UTSW	3	63781390	nonsense	probably null
R6326:Plch1	UTSW	3	63781390	nonsense	probably null
R6479:Plch1	UTSW	3	63744510	missense	probably benign	0.06
R6544:Plch1	UTSW	3	63850978	missense	probably damaging	1.00
R6767:Plch1	UTSW	3	63755344	missense	probably damaging	1.00
R6829:Plch1	UTSW	3	63697518	missense	probably damaging	0.99
R6891:Plch1	UTSW	3	63698083	missense	probably benign
R6893:Plch1	UTSW	3	63753141	nonsense	probably null
R6921:Plch1	UTSW	3	63707734	missense	possibly damaging	0.90
R7298:Plch1	UTSW	3	63716037	nonsense	probably null
R7396:Plch1	UTSW	3	63698954	missense	probably benign	0.00
R7420:Plch1	UTSW	3	63722857	missense	probably damaging	1.00
R7566:Plch1	UTSW	3	63781242	splice site	probably null
R7572:Plch1	UTSW	3	63740684	missense	possibly damaging	0.89
R7649:Plch1	UTSW	3	63698169	nonsense	probably null
R7696:Plch1	UTSW	3	63755305	missense	probably benign
R7851:Plch1	UTSW	3	63698434	missense	probably damaging	0.99
R7853:Plch1	UTSW	3	63773647	missense	probably benign	0.44
R7932:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R7983:Plch1	UTSW	3	63707743	missense	probably damaging	1.00
R8057:Plch1	UTSW	3	63698136	missense	probably benign
R8066:Plch1	UTSW	3	63711057	nonsense	probably null
R8206:Plch1	UTSW	3	63702626	splice site	probably null
R8678:Plch1	UTSW	3	63716047	nonsense	probably null
R8731:Plch1	UTSW	3	63697638	missense	probably benign	0.37
R8739:Plch1	UTSW	3	63870685	missense	possibly damaging	0.66
R8853:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R8875:Plch1	UTSW	3	63710970	missense	probably damaging	1.00
R8945:Plch1	UTSW	3	63731618	missense	probably benign	0.02
R8947:Plch1	UTSW	3	63784126	missense	probably damaging	0.99
R8953:Plch1	UTSW	3	63731705	missense	possibly damaging	0.94
R9065:Plch1	UTSW	3	63767503	missense	probably damaging	1.00
R9068:Plch1	UTSW	3	63704615	missense	probably damaging	1.00
R9188:Plch1	UTSW	3	63731654	missense	probably null	1.00
R9238:Plch1	UTSW	3	63698991	missense	possibly damaging	0.53
R9478:Plch1	UTSW	3	63699404	missense	probably benign	0.01
R9526:Plch1	UTSW	3	63851128	intron	probably benign
R9539:Plch1	UTSW	3	63784006	missense	probably null	0.01
R9634:Plch1	UTSW	3	63697731	missense	probably damaging	1.00
R9643:Plch1	UTSW	3	63753326	missense
R9659:Plch1	UTSW	3	63773715	missense	probably benign	0.17
R9711:Plch1	UTSW	3	63707755	missense	probably damaging	1.00
R9788:Plch1	UTSW	3	63773715	missense	probably benign	0.17
R9799:Plch1	UTSW	3	63698170	missense	possibly damaging	0.89
RF018:Plch1	UTSW	3	63721215	missense	probably damaging	1.00
X0028:Plch1	UTSW	3	63744509	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ATGCCCTGGGACACTGATTG -3'
(R):5'- GCTGGCTTTGTGTATAACCATTTC -3'

Sequencing Primer
(F):5'- TGGGACACTGATTGACATCC -3'
(R):5'- TCTCAAGTTCAGATGCAAAAACG -3'

Posted On

2014-10-16