Mutagenetix > Incidental Mutation

Incidental Mutation 'R2259:Rpe65'

243614

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

040259-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.304) question?

Stock #

R2259 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 159615571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 340 (Y340C)

Ref Sequence

ENSEMBL: ENSMUSP00000143654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000029824
AA Change: Y340C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: Y340C

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196999
AA Change: Y340C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: Y340C

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrd1	T	G	5: 129,112,311	S91A	possibly damaging	Het
Ankrd13b	T	G	11: 77,476,342	N247T	probably damaging	Het
Atp10b	A	G	11: 43,172,745	D169G	probably damaging	Het
Atp10b	G	A	11: 43,189,613	V239M	probably damaging	Het
Cflar	C	T	1: 58,729,121	T121I	probably benign	Het
Clca3b	T	C	3: 144,846,381	N180D	possibly damaging	Het
Cnbd2	T	A	2: 156,335,272	I62N	probably damaging	Het
Col11a2	A	G	17: 34,039,677	H8R	probably benign	Het
Cyp2a4	C	T	7: 26,309,035	L201F	probably damaging	Het
D630003M21Rik	A	T	2: 158,204,711	L782Q	probably damaging	Het
Dctn1	C	A	6: 83,197,586	H1065N	possibly damaging	Het
Dgcr2	A	T	16: 17,844,977		probably null	Het
Dlg4	T	C	11: 70,031,370	I143T	probably damaging	Het
E2f7	T	G	10: 110,746,343	N4K	probably damaging	Het
Eef2kmt	C	T	16: 5,245,308	V323I	probably benign	Het
Eif2ak4	A	C	2: 118,455,783	I1017L	probably damaging	Het
Eln	C	A	5: 134,729,654	A126S	unknown	Het
Exoc7	T	C	11: 116,306,411	S35G	probably damaging	Het
Fam187a	A	G	11: 102,885,298		probably benign	Het
Fam196a	T	A	7: 134,917,667	E378V	probably damaging	Het
Fkbp6	C	T	5: 135,337,614		probably null	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fmn2	T	A	1: 174,502,932	L296H	unknown	Het
Galnt14	C	A	17: 73,494,266	M520I	probably benign	Het
Gba2	A	G	4: 43,570,107	C396R	probably benign	Het
Gigyf1	C	A	5: 137,520,332	A215E	possibly damaging	Het
Glb1	C	T	9: 114,443,032	Q246*	probably null	Het
Gm11565	T	G	11: 99,915,018	C79G	possibly damaging	Het
Gpr160	A	G	3: 30,896,295	Y172C	probably damaging	Het
Ift52	A	G	2: 163,028,093	N159S	probably benign	Het
Insrr	A	G	3: 87,800,452	D67G	probably damaging	Het
Irf2	A	G	8: 46,837,833	Y230C	probably benign	Het
Jmjd6	T	C	11: 116,841,314	H187R	probably damaging	Het
Kdm2b	C	T	5: 122,882,416	G90S	probably damaging	Het
Kif7	C	T	7: 79,711,589	G118D	probably damaging	Het
Klhl38	G	C	15: 58,314,978	T532S	possibly damaging	Het
Kmt2a	G	T	9: 44,881,142		probably benign	Het
Lama2	A	G	10: 27,031,127	L2346S	probably benign	Het
Marveld2	A	G	13: 100,612,470	S34P	probably benign	Het
Mettl7a1	A	T	15: 100,313,168	I174F	probably benign	Het
Mllt6	T	C	11: 97,664,976	V44A	probably damaging	Het
Muc5ac	A	G	7: 141,791,008	N72S	probably benign	Het
Myo7a	T	G	7: 98,069,499	D1388A	probably damaging	Het
Ncapd3	A	G	9: 27,056,072	D568G	probably benign	Het
Ncoa1	A	C	12: 4,315,819	H82Q	probably damaging	Het
Npbwr1	C	A	1: 5,916,658	L212F	probably damaging	Het
Nptx1	T	G	11: 119,543,316	I315L	probably benign	Het
Npy2r	G	T	3: 82,541,354	P38Q	possibly damaging	Het
Ocln	A	T	13: 100,535,029	D24E	probably damaging	Het
Olfr1350	A	T	7: 6,570,023	I11F	probably damaging	Het
Olfr295	T	A	7: 86,585,884	V203D	possibly damaging	Het
Olfr933	T	C	9: 38,976,000	V108A	probably benign	Het
Pde2a	A	T	7: 101,484,567	D85V	probably damaging	Het
Phf3	A	G	1: 30,804,343	V1845A	probably benign	Het
Plch1	T	A	3: 63,697,977	Q1493L	possibly damaging	Het
Pold1	T	C	7: 44,541,484		probably benign	Het
Polq	T	C	16: 37,062,097	V1541A	probably benign	Het
Psmd3	T	A	11: 98,690,964	M305K	probably benign	Het
Pura	T	C	18: 36,287,750	F197L	possibly damaging	Het
Rab3gap2	T	A	1: 185,221,859	W43R	probably damaging	Het
Repin1	A	G	6: 48,596,530	Q128R	probably benign	Het
Rnf208	G	A	2: 25,243,644	V117I	probably damaging	Het
Ryr1	C	A	7: 29,019,741	V4414L	unknown	Het
Sephs2	T	C	7: 127,273,477	E148G	possibly damaging	Het
Spns2	T	A	11: 72,457,268	Q291L	probably benign	Het
Ssc5d	C	T	7: 4,943,916	P1090S	probably benign	Het
Tasp1	A	T	2: 139,951,506	V250D	probably damaging	Het
Tcaf3	A	G	6: 42,591,430	I664T	possibly damaging	Het
Tg	T	C	15: 66,683,898	V813A	probably benign	Het
Tmem132c	T	C	5: 127,504,924	L401P	probably benign	Het
Tmem138	T	C	19: 10,571,603	N101S	probably benign	Het
Tmem242	G	T	17: 5,433,470	A99E	probably damaging	Het
Tmem30a	C	T	9: 79,774,164	R277H	probably benign	Het
Tnni3	T	A	7: 4,519,406	I182F	probably benign	Het
Trim30a	T	A	7: 104,411,504	D355V	probably damaging	Het
Trim35	C	T	14: 66,309,262	R493*	probably null	Het
Trip10	G	C	17: 57,255,135	V254L	probably benign	Het
Tshz2	A	T	2: 169,886,406	Q505L	probably benign	Het
Ttyh1	T	C	7: 4,128,184	V218A	probably damaging	Het
Unc13b	A	T	4: 43,182,780	E3163V	possibly damaging	Het
Unc45b	T	A	11: 82,917,799	M237K	probably benign	Het
Usp8	A	G	2: 126,758,568	T1080A	probably benign	Het
Vmn2r65	T	A	7: 84,940,911	H599L	possibly damaging	Het
Vps13c	A	G	9: 67,953,860	N2891S	probably benign	Het
Xpo5	C	T	17: 46,240,896	Q1050*	probably null	Het
Zfp407	G	T	18: 84,209,793	T1897K	probably damaging	Het
Zzef1	C	T	11: 72,900,633	R2188*	probably null	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGTGACCTAAGGAACAATCAC -3'
(R):5'- GATGGGAATCACTGGGTCTG -3'

Sequencing Primer
(F):5'- CCAACAGTGGTAGAGCACTTGTC -3'
(R):5'- GTGGAAGTCACCCTTTCTAAATCAC -3'

Posted On

2014-10-16