Incidental Mutation 'R2259:Unc13b'
ID243615
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Nameunc-13 homolog B (C. elegans)
SynonymsUnc13h2, Munc13-2
MMRRC Submission 040259-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.760) question?
Stock #R2259 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43058953-43264871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43182780 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 3163 (E3163V)
Ref Sequence ENSEMBL: ENSMUSP00000147100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]
Predicted Effect probably benign
Transcript: ENSMUST00000079978
AA Change: E363V

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: E363V

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
AA Change: E375V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: E375V

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
AA Change: E363V

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: E363V

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132310
Predicted Effect probably benign
Transcript: ENSMUST00000163653
AA Change: E375V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: E375V

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168032
AA Change: E29V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456
AA Change: E29V

DomainStartEndE-ValueType
C1 147 196 4.21e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207569
AA Change: E3163V

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,112,311 S91A possibly damaging Het
Ankrd13b T G 11: 77,476,342 N247T probably damaging Het
Atp10b A G 11: 43,172,745 D169G probably damaging Het
Atp10b G A 11: 43,189,613 V239M probably damaging Het
Cflar C T 1: 58,729,121 T121I probably benign Het
Clca3b T C 3: 144,846,381 N180D possibly damaging Het
Cnbd2 T A 2: 156,335,272 I62N probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Cyp2a4 C T 7: 26,309,035 L201F probably damaging Het
D630003M21Rik A T 2: 158,204,711 L782Q probably damaging Het
Dctn1 C A 6: 83,197,586 H1065N possibly damaging Het
Dgcr2 A T 16: 17,844,977 probably null Het
Dlg4 T C 11: 70,031,370 I143T probably damaging Het
E2f7 T G 10: 110,746,343 N4K probably damaging Het
Eef2kmt C T 16: 5,245,308 V323I probably benign Het
Eif2ak4 A C 2: 118,455,783 I1017L probably damaging Het
Eln C A 5: 134,729,654 A126S unknown Het
Exoc7 T C 11: 116,306,411 S35G probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam196a T A 7: 134,917,667 E378V probably damaging Het
Fkbp6 C T 5: 135,337,614 probably null Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fmn2 T A 1: 174,502,932 L296H unknown Het
Galnt14 C A 17: 73,494,266 M520I probably benign Het
Gba2 A G 4: 43,570,107 C396R probably benign Het
Gigyf1 C A 5: 137,520,332 A215E possibly damaging Het
Glb1 C T 9: 114,443,032 Q246* probably null Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gpr160 A G 3: 30,896,295 Y172C probably damaging Het
Ift52 A G 2: 163,028,093 N159S probably benign Het
Insrr A G 3: 87,800,452 D67G probably damaging Het
Irf2 A G 8: 46,837,833 Y230C probably benign Het
Jmjd6 T C 11: 116,841,314 H187R probably damaging Het
Kdm2b C T 5: 122,882,416 G90S probably damaging Het
Kif7 C T 7: 79,711,589 G118D probably damaging Het
Klhl38 G C 15: 58,314,978 T532S possibly damaging Het
Kmt2a G T 9: 44,881,142 probably benign Het
Lama2 A G 10: 27,031,127 L2346S probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo7a T G 7: 98,069,499 D1388A probably damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Ncoa1 A C 12: 4,315,819 H82Q probably damaging Het
Npbwr1 C A 1: 5,916,658 L212F probably damaging Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Npy2r G T 3: 82,541,354 P38Q possibly damaging Het
Ocln A T 13: 100,535,029 D24E probably damaging Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr295 T A 7: 86,585,884 V203D possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Phf3 A G 1: 30,804,343 V1845A probably benign Het
Plch1 T A 3: 63,697,977 Q1493L possibly damaging Het
Pold1 T C 7: 44,541,484 probably benign Het
Polq T C 16: 37,062,097 V1541A probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Pura T C 18: 36,287,750 F197L possibly damaging Het
Rab3gap2 T A 1: 185,221,859 W43R probably damaging Het
Repin1 A G 6: 48,596,530 Q128R probably benign Het
Rnf208 G A 2: 25,243,644 V117I probably damaging Het
Rpe65 A G 3: 159,615,571 Y340C probably damaging Het
Ryr1 C A 7: 29,019,741 V4414L unknown Het
Sephs2 T C 7: 127,273,477 E148G possibly damaging Het
Spns2 T A 11: 72,457,268 Q291L probably benign Het
Ssc5d C T 7: 4,943,916 P1090S probably benign Het
Tasp1 A T 2: 139,951,506 V250D probably damaging Het
Tcaf3 A G 6: 42,591,430 I664T possibly damaging Het
Tg T C 15: 66,683,898 V813A probably benign Het
Tmem132c T C 5: 127,504,924 L401P probably benign Het
Tmem138 T C 19: 10,571,603 N101S probably benign Het
Tmem242 G T 17: 5,433,470 A99E probably damaging Het
Tmem30a C T 9: 79,774,164 R277H probably benign Het
Tnni3 T A 7: 4,519,406 I182F probably benign Het
Trim30a T A 7: 104,411,504 D355V probably damaging Het
Trim35 C T 14: 66,309,262 R493* probably null Het
Trip10 G C 17: 57,255,135 V254L probably benign Het
Tshz2 A T 2: 169,886,406 Q505L probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Usp8 A G 2: 126,758,568 T1080A probably benign Het
Vmn2r65 T A 7: 84,940,911 H599L possibly damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zfp407 G T 18: 84,209,793 T1897K probably damaging Het
Zzef1 C T 11: 72,900,633 R2188* probably null Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
R7735:Unc13b UTSW 4 43165791 missense probably damaging 1.00
R7756:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177330 small insertion probably benign
R7757:Unc13b UTSW 4 43177341 small insertion probably benign
R7758:Unc13b UTSW 4 43177312 small insertion probably benign
R7758:Unc13b UTSW 4 43177344 small insertion probably benign
R7781:Unc13b UTSW 4 43259546 missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43172737 missense unknown
R7858:Unc13b UTSW 4 43176285 missense unknown
R7867:Unc13b UTSW 4 43232573 nonsense probably null
R7897:Unc13b UTSW 4 43171860 missense unknown
R7904:Unc13b UTSW 4 43217075 missense probably benign
R7941:Unc13b UTSW 4 43176285 missense unknown
R7950:Unc13b UTSW 4 43232573 nonsense probably null
R7980:Unc13b UTSW 4 43171860 missense unknown
R7987:Unc13b UTSW 4 43217075 missense probably benign
R8069:Unc13b UTSW 4 43177597 missense unknown
R8101:Unc13b UTSW 4 43239918 missense probably benign 0.08
RF016:Unc13b UTSW 4 43177347 small insertion probably benign
RF016:Unc13b UTSW 4 43177350 small insertion probably benign
RF041:Unc13b UTSW 4 43177338 small insertion probably benign
RF056:Unc13b UTSW 4 43177359 small insertion probably benign
Z1176:Unc13b UTSW 4 43171419 missense unknown
Z1176:Unc13b UTSW 4 43177191 missense unknown
Z1176:Unc13b UTSW 4 43177764 missense unknown
Z1176:Unc13b UTSW 4 43261043 missense probably benign 0.11
Z1177:Unc13b UTSW 4 43173669 missense unknown
Predicted Primers PCR Primer
(F):5'- CGATCTGTGACTTCTGCACTTG -3'
(R):5'- GCACGCTGCAAGAAGATGAC -3'

Sequencing Primer
(F):5'- ACTTGATGCTGACCCAGGC -3'
(R):5'- CGCTGCAAGAAGATGACTAATTACTG -3'
Posted On2014-10-16