Mutagenetix > Incidental Mutations

Incidental Mutation 'R2259:Unc13b'

243615

Institutional Source

Beutler Lab

Gene Symbol

Unc13b

Ensembl Gene

ENSMUSG00000028456

Gene Name

unc-13 homolog B (C. elegans)

Synonyms

Unc13h2, Munc13-2

MMRRC Submission

040259-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.273) question?

Stock #

R2259 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43058953-43264871 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43182780 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 3163 (E3163V)

Ref Sequence

ENSEMBL: ENSMUSP00000147100 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]

Predicted Effect

probably benign
Transcript: ENSMUST00000079978
AA Change: E363V

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: E363V

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1262	1404	4.8e-60	PFAM
C2	1438	1544	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107952
AA Change: E375V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: E375V

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1033	2.02e-53	SMART
Pfam:Membr_traf_MHD	1274	1416	4.8e-60	PFAM
C2	1450	1556	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107953
AA Change: E363V

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: E363V

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1263	1403	2.3e-56	PFAM
C2	1457	1563	7.56e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132310

Predicted Effect

probably benign
Transcript: ENSMUST00000163653
AA Change: E375V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: E375V

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1032	4.64e-53	SMART
Pfam:Membr_traf_MHD	1273	1415	4.8e-60	PFAM
C2	1449	1555	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168032
AA Change: E29V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456
AA Change: E29V

Domain	Start	End	E-Value	Type
C1	147	196	4.21e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207569
AA Change: E3163V

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrd1	T	G	5: 129,112,311	S91A	possibly damaging	Het
Ankrd13b	T	G	11: 77,476,342	N247T	probably damaging	Het
Atp10b	A	G	11: 43,172,745	D169G	probably damaging	Het
Atp10b	G	A	11: 43,189,613	V239M	probably damaging	Het
Cflar	C	T	1: 58,729,121	T121I	probably benign	Het
Clca3b	T	C	3: 144,846,381	N180D	possibly damaging	Het
Cnbd2	T	A	2: 156,335,272	I62N	probably damaging	Het
Col11a2	A	G	17: 34,039,677	H8R	probably benign	Het
Cyp2a4	C	T	7: 26,309,035	L201F	probably damaging	Het
D630003M21Rik	A	T	2: 158,204,711	L782Q	probably damaging	Het
Dctn1	C	A	6: 83,197,586	H1065N	possibly damaging	Het
Dgcr2	A	T	16: 17,844,977		probably null	Het
Dlg4	T	C	11: 70,031,370	I143T	probably damaging	Het
E2f7	T	G	10: 110,746,343	N4K	probably damaging	Het
Eef2kmt	C	T	16: 5,245,308	V323I	probably benign	Het
Eif2ak4	A	C	2: 118,455,783	I1017L	probably damaging	Het
Eln	C	A	5: 134,729,654	A126S	unknown	Het
Exoc7	T	C	11: 116,306,411	S35G	probably damaging	Het
Fam187a	A	G	11: 102,885,298		probably benign	Het
Fam196a	T	A	7: 134,917,667	E378V	probably damaging	Het
Fkbp6	C	T	5: 135,337,614		probably null	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fmn2	T	A	1: 174,502,932	L296H	unknown	Het
Galnt14	C	A	17: 73,494,266	M520I	probably benign	Het
Gba2	A	G	4: 43,570,107	C396R	probably benign	Het
Gigyf1	C	A	5: 137,520,332	A215E	possibly damaging	Het
Glb1	C	T	9: 114,443,032	Q246*	probably null	Het
Gm11565	T	G	11: 99,915,018	C79G	possibly damaging	Het
Gpr160	A	G	3: 30,896,295	Y172C	probably damaging	Het
Ift52	A	G	2: 163,028,093	N159S	probably benign	Het
Insrr	A	G	3: 87,800,452	D67G	probably damaging	Het
Irf2	A	G	8: 46,837,833	Y230C	probably benign	Het
Jmjd6	T	C	11: 116,841,314	H187R	probably damaging	Het
Kdm2b	C	T	5: 122,882,416	G90S	probably damaging	Het
Kif7	C	T	7: 79,711,589	G118D	probably damaging	Het
Klhl38	G	C	15: 58,314,978	T532S	possibly damaging	Het
Kmt2a	G	T	9: 44,881,142		probably benign	Het
Lama2	A	G	10: 27,031,127	L2346S	probably benign	Het
Marveld2	A	G	13: 100,612,470	S34P	probably benign	Het
Mettl7a1	A	T	15: 100,313,168	I174F	probably benign	Het
Mllt6	T	C	11: 97,664,976	V44A	probably damaging	Het
Muc5ac	A	G	7: 141,791,008	N72S	probably benign	Het
Myo7a	T	G	7: 98,069,499	D1388A	probably damaging	Het
Ncapd3	A	G	9: 27,056,072	D568G	probably benign	Het
Ncoa1	A	C	12: 4,315,819	H82Q	probably damaging	Het
Npbwr1	C	A	1: 5,916,658	L212F	probably damaging	Het
Nptx1	T	G	11: 119,543,316	I315L	probably benign	Het
Npy2r	G	T	3: 82,541,354	P38Q	possibly damaging	Het
Ocln	A	T	13: 100,535,029	D24E	probably damaging	Het
Olfr1350	A	T	7: 6,570,023	I11F	probably damaging	Het
Olfr295	T	A	7: 86,585,884	V203D	possibly damaging	Het
Olfr933	T	C	9: 38,976,000	V108A	probably benign	Het
Pde2a	A	T	7: 101,484,567	D85V	probably damaging	Het
Phf3	A	G	1: 30,804,343	V1845A	probably benign	Het
Plch1	T	A	3: 63,697,977	Q1493L	possibly damaging	Het
Pold1	T	C	7: 44,541,484		probably benign	Het
Polq	T	C	16: 37,062,097	V1541A	probably benign	Het
Psmd3	T	A	11: 98,690,964	M305K	probably benign	Het
Pura	T	C	18: 36,287,750	F197L	possibly damaging	Het
Rab3gap2	T	A	1: 185,221,859	W43R	probably damaging	Het
Repin1	A	G	6: 48,596,530	Q128R	probably benign	Het
Rnf208	G	A	2: 25,243,644	V117I	probably damaging	Het
Rpe65	A	G	3: 159,615,571	Y340C	probably damaging	Het
Ryr1	C	A	7: 29,019,741	V4414L	unknown	Het
Sephs2	T	C	7: 127,273,477	E148G	possibly damaging	Het
Spns2	T	A	11: 72,457,268	Q291L	probably benign	Het
Ssc5d	C	T	7: 4,943,916	P1090S	probably benign	Het
Tasp1	A	T	2: 139,951,506	V250D	probably damaging	Het
Tcaf3	A	G	6: 42,591,430	I664T	possibly damaging	Het
Tg	T	C	15: 66,683,898	V813A	probably benign	Het
Tmem132c	T	C	5: 127,504,924	L401P	probably benign	Het
Tmem138	T	C	19: 10,571,603	N101S	probably benign	Het
Tmem242	G	T	17: 5,433,470	A99E	probably damaging	Het
Tmem30a	C	T	9: 79,774,164	R277H	probably benign	Het
Tnni3	T	A	7: 4,519,406	I182F	probably benign	Het
Trim30a	T	A	7: 104,411,504	D355V	probably damaging	Het
Trim35	C	T	14: 66,309,262	R493*	probably null	Het
Trip10	G	C	17: 57,255,135	V254L	probably benign	Het
Tshz2	A	T	2: 169,886,406	Q505L	probably benign	Het
Ttyh1	T	C	7: 4,128,184	V218A	probably damaging	Het
Unc45b	T	A	11: 82,917,799	M237K	probably benign	Het
Usp8	A	G	2: 126,758,568	T1080A	probably benign	Het
Vmn2r65	T	A	7: 84,940,911	H599L	possibly damaging	Het
Vps13c	A	G	9: 67,953,860	N2891S	probably benign	Het
Xpo5	C	T	17: 46,240,896	Q1050*	probably null	Het
Zfp407	G	T	18: 84,209,793	T1897K	probably damaging	Het
Zzef1	C	T	11: 72,900,633	R2188*	probably null	Het

Other mutations in Unc13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Unc13b	APN	4	43240285	missense	probably damaging	1.00
IGL00832:Unc13b	APN	4	43258921	missense	probably damaging	1.00
IGL01111:Unc13b	APN	4	43096927	missense	possibly damaging	0.76
IGL01115:Unc13b	APN	4	43258492	missense	probably damaging	1.00
IGL01137:Unc13b	APN	4	43091291	missense	probably damaging	1.00
IGL01637:Unc13b	APN	4	43241066	missense	probably damaging	1.00
IGL01789:Unc13b	APN	4	43239462	missense	probably damaging	1.00
IGL01792:Unc13b	APN	4	43250218	missense	probably damaging	0.99
IGL01877:Unc13b	APN	4	43249583	critical splice donor site	probably null
IGL01924:Unc13b	APN	4	43239385	nonsense	probably null
IGL02087:Unc13b	APN	4	43091270	missense	probably null	1.00
IGL02197:Unc13b	APN	4	43165828	missense	probably damaging	0.99
IGL02504:Unc13b	APN	4	43263031	missense	probably damaging	1.00
IGL02659:Unc13b	APN	4	43235332	missense	probably damaging	1.00
IGL03031:Unc13b	APN	4	43235368	missense	probably damaging	1.00
IGL03036:Unc13b	APN	4	43235249	missense	probably damaging	1.00
IGL03209:Unc13b	APN	4	43239351	missense	probably damaging	0.99
IGL03352:Unc13b	APN	4	43237110	missense	possibly damaging	0.90
BB006:Unc13b	UTSW	4	43174399	missense	unknown
BB016:Unc13b	UTSW	4	43174399	missense	unknown
P0028:Unc13b	UTSW	4	43256225	missense	probably damaging	1.00
PIT4585001:Unc13b	UTSW	4	43091298	missense	probably benign	0.03
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0335:Unc13b	UTSW	4	43236983	missense	possibly damaging	0.95
R0504:Unc13b	UTSW	4	43263559	missense	probably damaging	0.99
R0631:Unc13b	UTSW	4	43182849	missense	possibly damaging	0.47
R0748:Unc13b	UTSW	4	43241164	splice site	probably benign
R1275:Unc13b	UTSW	4	43235366	missense	probably damaging	1.00
R1293:Unc13b	UTSW	4	43235190	missense	probably damaging	1.00
R1434:Unc13b	UTSW	4	43239385	nonsense	probably null
R1552:Unc13b	UTSW	4	43237144	missense	probably damaging	0.99
R1591:Unc13b	UTSW	4	43244747	missense	probably damaging	1.00
R1628:Unc13b	UTSW	4	43263371	missense	probably damaging	1.00
R1740:Unc13b	UTSW	4	43240285	missense	probably damaging	1.00
R1839:Unc13b	UTSW	4	43258308	splice site	probably benign
R2045:Unc13b	UTSW	4	43091266	missense	probably damaging	1.00
R2191:Unc13b	UTSW	4	43245566	nonsense	probably null
R2307:Unc13b	UTSW	4	43239854	missense	probably damaging	0.98
R2317:Unc13b	UTSW	4	43245514	missense	probably damaging	1.00
R2402:Unc13b	UTSW	4	43095843	missense	probably benign
R2847:Unc13b	UTSW	4	43180404	missense	probably benign	0.04
R3414:Unc13b	UTSW	4	43234658	splice site	probably benign
R3436:Unc13b	UTSW	4	43097028	splice site	probably benign
R3955:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R3957:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R4015:Unc13b	UTSW	4	43237801	missense	probably damaging	1.00
R4650:Unc13b	UTSW	4	43261035	missense	probably damaging	0.97
R4836:Unc13b	UTSW	4	43237137	missense	probably damaging	1.00
R5041:Unc13b	UTSW	4	43237836	missense	probably benign	0.41
R5413:Unc13b	UTSW	4	43257936	critical splice donor site	probably null
R5994:Unc13b	UTSW	4	43172596	intron	probably benign
R6015:Unc13b	UTSW	4	43177995	nonsense	probably null
R6090:Unc13b	UTSW	4	43239306	missense	probably damaging	1.00
R6242:Unc13b	UTSW	4	43165800	missense	possibly damaging	0.92
R6246:Unc13b	UTSW	4	43216246	missense	probably benign	0.18
R6427:Unc13b	UTSW	4	43176966	unclassified	probably benign
R6660:Unc13b	UTSW	4	43177412	unclassified	probably benign
R6670:Unc13b	UTSW	4	43255562	missense	probably damaging	0.99
R6753:Unc13b	UTSW	4	43239331	missense	probably damaging	1.00
R6858:Unc13b	UTSW	4	43165828	missense	possibly damaging	0.85
R6886:Unc13b	UTSW	4	43170156	intron	probably benign
R6969:Unc13b	UTSW	4	43263538	missense	possibly damaging	0.94
R6994:Unc13b	UTSW	4	43171403	intron	probably benign
R6994:Unc13b	UTSW	4	43173203	intron	probably benign
R7080:Unc13b	UTSW	4	43171926	missense	unknown
R7117:Unc13b	UTSW	4	43216544	missense	probably benign	0.33
R7132:Unc13b	UTSW	4	43215757	missense	probably benign	0.17
R7181:Unc13b	UTSW	4	43258893	missense	probably damaging	0.99
R7192:Unc13b	UTSW	4	43258519	missense	probably damaging	1.00
R7246:Unc13b	UTSW	4	43172910	missense	unknown
R7342:Unc13b	UTSW	4	43258703	missense	probably damaging	0.99
R7345:Unc13b	UTSW	4	43173966	missense	unknown
R7355:Unc13b	UTSW	4	43237754	missense	probably damaging	1.00
R7391:Unc13b	UTSW	4	43216459	missense	probably benign	0.03
R7419:Unc13b	UTSW	4	43174023	missense	unknown
R7424:Unc13b	UTSW	4	43172235	missense	unknown
R7517:Unc13b	UTSW	4	43215765	missense	probably benign
R7532:Unc13b	UTSW	4	43249565	missense	probably benign	0.44
R7564:Unc13b	UTSW	4	43091258	missense	probably damaging	1.00
R7598:Unc13b	UTSW	4	43263569	missense	probably benign	0.20
R7604:Unc13b	UTSW	4	43170102	missense	unknown
R7604:Unc13b	UTSW	4	43256776	missense	possibly damaging	0.95
R7643:Unc13b	UTSW	4	43216333	missense	probably benign
R7718:Unc13b	UTSW	4	43173854	missense	unknown
R7735:Unc13b	UTSW	4	43165791	missense	probably damaging	1.00
R7756:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177330	small insertion	probably benign
R7757:Unc13b	UTSW	4	43177341	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177312	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177344	small insertion	probably benign
R7781:Unc13b	UTSW	4	43259546	missense	possibly damaging	0.87
R7793:Unc13b	UTSW	4	43172737	missense	unknown
R7858:Unc13b	UTSW	4	43176285	missense	unknown
R7867:Unc13b	UTSW	4	43232573	nonsense	probably null
R7897:Unc13b	UTSW	4	43171860	missense	unknown
R7904:Unc13b	UTSW	4	43217075	missense	probably benign
R7929:Unc13b	UTSW	4	43174399	missense	unknown
R7984:Unc13b	UTSW	4	43173973	missense	unknown
R8069:Unc13b	UTSW	4	43177597	missense	unknown
R8101:Unc13b	UTSW	4	43239918	missense	probably benign	0.08
R8246:Unc13b	UTSW	4	43175954	missense	unknown
R8289:Unc13b	UTSW	4	43172524	nonsense	probably null
R8301:Unc13b	UTSW	4	43263568	missense	probably benign
R8397:Unc13b	UTSW	4	43217290	missense	probably benign	0.12
R8421:Unc13b	UTSW	4	43178304	missense	unknown
R8738:Unc13b	UTSW	4	43177564	missense	unknown
R8746:Unc13b	UTSW	4	43176120	missense	unknown
R8766:Unc13b	UTSW	4	43174722	missense	unknown
RF016:Unc13b	UTSW	4	43177347	small insertion	probably benign
RF016:Unc13b	UTSW	4	43177350	small insertion	probably benign
RF041:Unc13b	UTSW	4	43177338	small insertion	probably benign
RF056:Unc13b	UTSW	4	43177359	small insertion	probably benign
Z1176:Unc13b	UTSW	4	43171419	missense	unknown
Z1176:Unc13b	UTSW	4	43177191	missense	unknown
Z1176:Unc13b	UTSW	4	43177764	missense	unknown
Z1176:Unc13b	UTSW	4	43261043	missense	probably benign	0.11
Z1177:Unc13b	UTSW	4	43173669	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CGATCTGTGACTTCTGCACTTG -3'
(R):5'- GCACGCTGCAAGAAGATGAC -3'

Sequencing Primer
(F):5'- ACTTGATGCTGACCCAGGC -3'
(R):5'- CGCTGCAAGAAGATGACTAATTACTG -3'

Posted On

2014-10-16