Incidental Mutation 'R2259:Gba2'
ID 243616
Institutional Source Beutler Lab
Gene Symbol Gba2
Ensembl Gene ENSMUSG00000028467
Gene Name glucosidase beta 2
Synonyms bile acid
MMRRC Submission 040259-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2259 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 43566928-43578873 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43570107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 396 (C396R)
Ref Sequence ENSEMBL: ENSMUSP00000030189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
AlphaFold Q69ZF3
Predicted Effect probably benign
Transcript: ENSMUST00000030189
AA Change: C396R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: C396R

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102944
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128403
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159923
Predicted Effect probably benign
Transcript: ENSMUST00000167751
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,189,375 (GRCm39) S91A possibly damaging Het
Ankrd13b T G 11: 77,367,168 (GRCm39) N247T probably damaging Het
Atp10b A G 11: 43,063,572 (GRCm39) D169G probably damaging Het
Atp10b G A 11: 43,080,440 (GRCm39) V239M probably damaging Het
Cflar C T 1: 58,768,280 (GRCm39) T121I probably benign Het
Clca3b T C 3: 144,552,142 (GRCm39) N180D possibly damaging Het
Cnbd2 T A 2: 156,177,192 (GRCm39) I62N probably damaging Het
Col11a2 A G 17: 34,258,651 (GRCm39) H8R probably benign Het
Cyp2a4 C T 7: 26,008,460 (GRCm39) L201F probably damaging Het
D630003M21Rik A T 2: 158,046,631 (GRCm39) L782Q probably damaging Het
Dctn1 C A 6: 83,174,568 (GRCm39) H1065N possibly damaging Het
Dgcr2 A T 16: 17,662,841 (GRCm39) probably null Het
Dlg4 T C 11: 69,922,196 (GRCm39) I143T probably damaging Het
E2f7 T G 10: 110,582,204 (GRCm39) N4K probably damaging Het
Eef2kmt C T 16: 5,063,172 (GRCm39) V323I probably benign Het
Eif2ak4 A C 2: 118,286,264 (GRCm39) I1017L probably damaging Het
Eln C A 5: 134,758,508 (GRCm39) A126S unknown Het
Exoc7 T C 11: 116,197,237 (GRCm39) S35G probably damaging Het
Fam187a A G 11: 102,776,124 (GRCm39) probably benign Het
Fkbp6 C T 5: 135,366,468 (GRCm39) probably null Het
Flnc G A 6: 29,438,665 (GRCm39) W186* probably null Het
Fmn2 T A 1: 174,330,498 (GRCm39) L296H unknown Het
Galnt14 C A 17: 73,801,261 (GRCm39) M520I probably benign Het
Gigyf1 C A 5: 137,518,594 (GRCm39) A215E possibly damaging Het
Glb1 C T 9: 114,272,100 (GRCm39) Q246* probably null Het
Gm11565 T G 11: 99,805,844 (GRCm39) C79G possibly damaging Het
Gpr160 A G 3: 30,950,444 (GRCm39) Y172C probably damaging Het
Ift52 A G 2: 162,870,013 (GRCm39) N159S probably benign Het
Insrr A G 3: 87,707,759 (GRCm39) D67G probably damaging Het
Insyn2a T A 7: 134,519,396 (GRCm39) E378V probably damaging Het
Irf2 A G 8: 47,290,868 (GRCm39) Y230C probably benign Het
Jmjd6 T C 11: 116,732,140 (GRCm39) H187R probably damaging Het
Kdm2b C T 5: 123,020,479 (GRCm39) G90S probably damaging Het
Kif7 C T 7: 79,361,337 (GRCm39) G118D probably damaging Het
Klhl38 G C 15: 58,178,374 (GRCm39) T532S possibly damaging Het
Kmt2a G T 9: 44,792,440 (GRCm39) probably benign Het
Lama2 A G 10: 26,907,123 (GRCm39) L2346S probably benign Het
Marveld2 A G 13: 100,748,978 (GRCm39) S34P probably benign Het
Mllt6 T C 11: 97,555,802 (GRCm39) V44A probably damaging Het
Muc5ac A G 7: 141,344,745 (GRCm39) N72S probably benign Het
Myo7a T G 7: 97,718,706 (GRCm39) D1388A probably damaging Het
Ncapd3 A G 9: 26,967,368 (GRCm39) D568G probably benign Het
Ncoa1 A C 12: 4,365,819 (GRCm39) H82Q probably damaging Het
Npbwr1 C A 1: 5,986,877 (GRCm39) L212F probably damaging Het
Nptx1 T G 11: 119,434,142 (GRCm39) I315L probably benign Het
Npy2r G T 3: 82,448,661 (GRCm39) P38Q possibly damaging Het
Ocln A T 13: 100,671,537 (GRCm39) D24E probably damaging Het
Or14c41 T A 7: 86,235,092 (GRCm39) V203D possibly damaging Het
Or5bw2 A T 7: 6,573,022 (GRCm39) I11F probably damaging Het
Or8d1b T C 9: 38,887,296 (GRCm39) V108A probably benign Het
Pde2a A T 7: 101,133,774 (GRCm39) D85V probably damaging Het
Phf3 A G 1: 30,843,424 (GRCm39) V1845A probably benign Het
Plch1 T A 3: 63,605,398 (GRCm39) Q1493L possibly damaging Het
Pold1 T C 7: 44,190,908 (GRCm39) probably benign Het
Polq T C 16: 36,882,459 (GRCm39) V1541A probably benign Het
Psmd3 T A 11: 98,581,790 (GRCm39) M305K probably benign Het
Pura T C 18: 36,420,803 (GRCm39) F197L possibly damaging Het
Rab3gap2 T A 1: 184,954,056 (GRCm39) W43R probably damaging Het
Repin1 A G 6: 48,573,464 (GRCm39) Q128R probably benign Het
Rnf208 G A 2: 25,133,656 (GRCm39) V117I probably damaging Het
Rpe65 A G 3: 159,321,208 (GRCm39) Y340C probably damaging Het
Ryr1 C A 7: 28,719,166 (GRCm39) V4414L unknown Het
Sephs2 T C 7: 126,872,649 (GRCm39) E148G possibly damaging Het
Spns2 T A 11: 72,348,094 (GRCm39) Q291L probably benign Het
Ssc5d C T 7: 4,946,915 (GRCm39) P1090S probably benign Het
Tasp1 A T 2: 139,793,426 (GRCm39) V250D probably damaging Het
Tcaf3 A G 6: 42,568,364 (GRCm39) I664T possibly damaging Het
Tg T C 15: 66,555,747 (GRCm39) V813A probably benign Het
Tmem132c T C 5: 127,581,988 (GRCm39) L401P probably benign Het
Tmem138 T C 19: 10,548,967 (GRCm39) N101S probably benign Het
Tmem242 G T 17: 5,483,745 (GRCm39) A99E probably damaging Het
Tmem30a C T 9: 79,681,446 (GRCm39) R277H probably benign Het
Tmt1a A T 15: 100,211,049 (GRCm39) I174F probably benign Het
Tnni3 T A 7: 4,522,405 (GRCm39) I182F probably benign Het
Trim30a T A 7: 104,060,711 (GRCm39) D355V probably damaging Het
Trim35 C T 14: 66,546,711 (GRCm39) R493* probably null Het
Trip10 G C 17: 57,562,135 (GRCm39) V254L probably benign Het
Tshz2 A T 2: 169,728,326 (GRCm39) Q505L probably benign Het
Ttyh1 T C 7: 4,131,183 (GRCm39) V218A probably damaging Het
Unc13b A T 4: 43,182,780 (GRCm39) E3163V possibly damaging Het
Unc45b T A 11: 82,808,625 (GRCm39) M237K probably benign Het
Usp8 A G 2: 126,600,488 (GRCm39) T1080A probably benign Het
Vmn2r65 T A 7: 84,590,119 (GRCm39) H599L possibly damaging Het
Vps13c A G 9: 67,861,142 (GRCm39) N2891S probably benign Het
Xpo5 C T 17: 46,551,822 (GRCm39) Q1050* probably null Het
Zfp407 G T 18: 84,227,918 (GRCm39) T1897K probably damaging Het
Zzef1 C T 11: 72,791,459 (GRCm39) R2188* probably null Het
Other mutations in Gba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Gba2 APN 4 43,568,477 (GRCm39) missense probably damaging 1.00
IGL01577:Gba2 APN 4 43,573,753 (GRCm39) nonsense probably null
IGL02066:Gba2 APN 4 43,570,175 (GRCm39) missense probably benign 0.18
IGL02126:Gba2 APN 4 43,567,918 (GRCm39) critical splice acceptor site probably null
IGL02243:Gba2 APN 4 43,568,719 (GRCm39) missense probably benign 0.13
IGL02474:Gba2 APN 4 43,568,538 (GRCm39) missense possibly damaging 0.69
IGL02567:Gba2 APN 4 43,567,281 (GRCm39) missense probably benign
IGL02628:Gba2 APN 4 43,568,919 (GRCm39) missense probably benign 0.01
IGL02706:Gba2 APN 4 43,567,257 (GRCm39) missense probably benign 0.01
IGL02795:Gba2 APN 4 43,578,331 (GRCm39) missense probably damaging 1.00
R0389:Gba2 UTSW 4 43,570,832 (GRCm39) missense probably damaging 1.00
R0555:Gba2 UTSW 4 43,569,927 (GRCm39) missense probably damaging 1.00
R0650:Gba2 UTSW 4 43,570,424 (GRCm39) splice site probably null
R1603:Gba2 UTSW 4 43,567,823 (GRCm39) missense probably damaging 1.00
R1628:Gba2 UTSW 4 43,570,118 (GRCm39) missense probably benign 0.00
R1664:Gba2 UTSW 4 43,578,080 (GRCm39) missense probably benign 0.01
R1686:Gba2 UTSW 4 43,573,869 (GRCm39) splice site probably benign
R1730:Gba2 UTSW 4 43,578,242 (GRCm39) missense probably benign 0.01
R2036:Gba2 UTSW 4 43,568,118 (GRCm39) unclassified probably benign
R2061:Gba2 UTSW 4 43,574,029 (GRCm39) nonsense probably null
R2847:Gba2 UTSW 4 43,568,000 (GRCm39) splice site probably null
R3026:Gba2 UTSW 4 43,578,308 (GRCm39) missense possibly damaging 0.95
R3617:Gba2 UTSW 4 43,573,803 (GRCm39) missense probably damaging 1.00
R4225:Gba2 UTSW 4 43,569,464 (GRCm39) unclassified probably benign
R4346:Gba2 UTSW 4 43,571,337 (GRCm39) missense probably benign 0.04
R4601:Gba2 UTSW 4 43,573,810 (GRCm39) missense probably damaging 1.00
R4611:Gba2 UTSW 4 43,568,092 (GRCm39) missense probably damaging 1.00
R4664:Gba2 UTSW 4 43,568,619 (GRCm39) unclassified probably benign
R4784:Gba2 UTSW 4 43,568,315 (GRCm39) missense probably damaging 1.00
R4785:Gba2 UTSW 4 43,568,315 (GRCm39) missense probably damaging 1.00
R5079:Gba2 UTSW 4 43,568,640 (GRCm39) unclassified probably benign
R5327:Gba2 UTSW 4 43,574,063 (GRCm39) missense probably damaging 1.00
R5746:Gba2 UTSW 4 43,568,465 (GRCm39) splice site probably null
R6052:Gba2 UTSW 4 43,568,330 (GRCm39) missense probably damaging 1.00
R6485:Gba2 UTSW 4 43,574,118 (GRCm39) missense probably damaging 1.00
R7073:Gba2 UTSW 4 43,573,753 (GRCm39) missense probably damaging 1.00
R7112:Gba2 UTSW 4 43,568,453 (GRCm39) missense probably benign 0.01
R7472:Gba2 UTSW 4 43,568,967 (GRCm39) missense probably benign 0.44
R8220:Gba2 UTSW 4 43,568,510 (GRCm39) missense probably damaging 1.00
R8315:Gba2 UTSW 4 43,569,937 (GRCm39) frame shift probably null
R8476:Gba2 UTSW 4 43,569,944 (GRCm39) missense probably damaging 0.98
R8477:Gba2 UTSW 4 43,569,944 (GRCm39) missense probably damaging 0.98
R8794:Gba2 UTSW 4 43,568,077 (GRCm39) missense probably damaging 0.98
R9087:Gba2 UTSW 4 43,568,304 (GRCm39) missense probably benign 0.09
R9193:Gba2 UTSW 4 43,578,112 (GRCm39) missense probably benign 0.26
R9753:Gba2 UTSW 4 43,568,716 (GRCm39) missense probably damaging 1.00
RF007:Gba2 UTSW 4 43,569,894 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGTGGCACAGTGCATAGTGG -3'
(R):5'- GACCTGATAATGAATGGGCCTTG -3'

Sequencing Primer
(F):5'- CACAGTGCATAGTGGCTCAG -3'
(R):5'- GGGCCTTGTCTTCAAATTAGAAGTCC -3'
Posted On 2014-10-16