Incidental Mutation 'R2259:Tcaf3'
ID 243624
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 040259-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R2259 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42568364 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 664 (I664T)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect possibly damaging
Transcript: ENSMUST00000069023
AA Change: I664T

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: I664T

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151898
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,189,375 (GRCm39) S91A possibly damaging Het
Ankrd13b T G 11: 77,367,168 (GRCm39) N247T probably damaging Het
Atp10b A G 11: 43,063,572 (GRCm39) D169G probably damaging Het
Atp10b G A 11: 43,080,440 (GRCm39) V239M probably damaging Het
Cflar C T 1: 58,768,280 (GRCm39) T121I probably benign Het
Clca3b T C 3: 144,552,142 (GRCm39) N180D possibly damaging Het
Cnbd2 T A 2: 156,177,192 (GRCm39) I62N probably damaging Het
Col11a2 A G 17: 34,258,651 (GRCm39) H8R probably benign Het
Cyp2a4 C T 7: 26,008,460 (GRCm39) L201F probably damaging Het
D630003M21Rik A T 2: 158,046,631 (GRCm39) L782Q probably damaging Het
Dctn1 C A 6: 83,174,568 (GRCm39) H1065N possibly damaging Het
Dgcr2 A T 16: 17,662,841 (GRCm39) probably null Het
Dlg4 T C 11: 69,922,196 (GRCm39) I143T probably damaging Het
E2f7 T G 10: 110,582,204 (GRCm39) N4K probably damaging Het
Eef2kmt C T 16: 5,063,172 (GRCm39) V323I probably benign Het
Eif2ak4 A C 2: 118,286,264 (GRCm39) I1017L probably damaging Het
Eln C A 5: 134,758,508 (GRCm39) A126S unknown Het
Exoc7 T C 11: 116,197,237 (GRCm39) S35G probably damaging Het
Fam187a A G 11: 102,776,124 (GRCm39) probably benign Het
Fkbp6 C T 5: 135,366,468 (GRCm39) probably null Het
Flnc G A 6: 29,438,665 (GRCm39) W186* probably null Het
Fmn2 T A 1: 174,330,498 (GRCm39) L296H unknown Het
Galnt14 C A 17: 73,801,261 (GRCm39) M520I probably benign Het
Gba2 A G 4: 43,570,107 (GRCm39) C396R probably benign Het
Gigyf1 C A 5: 137,518,594 (GRCm39) A215E possibly damaging Het
Glb1 C T 9: 114,272,100 (GRCm39) Q246* probably null Het
Gm11565 T G 11: 99,805,844 (GRCm39) C79G possibly damaging Het
Gpr160 A G 3: 30,950,444 (GRCm39) Y172C probably damaging Het
Ift52 A G 2: 162,870,013 (GRCm39) N159S probably benign Het
Insrr A G 3: 87,707,759 (GRCm39) D67G probably damaging Het
Insyn2a T A 7: 134,519,396 (GRCm39) E378V probably damaging Het
Irf2 A G 8: 47,290,868 (GRCm39) Y230C probably benign Het
Jmjd6 T C 11: 116,732,140 (GRCm39) H187R probably damaging Het
Kdm2b C T 5: 123,020,479 (GRCm39) G90S probably damaging Het
Kif7 C T 7: 79,361,337 (GRCm39) G118D probably damaging Het
Klhl38 G C 15: 58,178,374 (GRCm39) T532S possibly damaging Het
Kmt2a G T 9: 44,792,440 (GRCm39) probably benign Het
Lama2 A G 10: 26,907,123 (GRCm39) L2346S probably benign Het
Marveld2 A G 13: 100,748,978 (GRCm39) S34P probably benign Het
Mllt6 T C 11: 97,555,802 (GRCm39) V44A probably damaging Het
Muc5ac A G 7: 141,344,745 (GRCm39) N72S probably benign Het
Myo7a T G 7: 97,718,706 (GRCm39) D1388A probably damaging Het
Ncapd3 A G 9: 26,967,368 (GRCm39) D568G probably benign Het
Ncoa1 A C 12: 4,365,819 (GRCm39) H82Q probably damaging Het
Npbwr1 C A 1: 5,986,877 (GRCm39) L212F probably damaging Het
Nptx1 T G 11: 119,434,142 (GRCm39) I315L probably benign Het
Npy2r G T 3: 82,448,661 (GRCm39) P38Q possibly damaging Het
Ocln A T 13: 100,671,537 (GRCm39) D24E probably damaging Het
Or14c41 T A 7: 86,235,092 (GRCm39) V203D possibly damaging Het
Or5bw2 A T 7: 6,573,022 (GRCm39) I11F probably damaging Het
Or8d1b T C 9: 38,887,296 (GRCm39) V108A probably benign Het
Pde2a A T 7: 101,133,774 (GRCm39) D85V probably damaging Het
Phf3 A G 1: 30,843,424 (GRCm39) V1845A probably benign Het
Plch1 T A 3: 63,605,398 (GRCm39) Q1493L possibly damaging Het
Pold1 T C 7: 44,190,908 (GRCm39) probably benign Het
Polq T C 16: 36,882,459 (GRCm39) V1541A probably benign Het
Psmd3 T A 11: 98,581,790 (GRCm39) M305K probably benign Het
Pura T C 18: 36,420,803 (GRCm39) F197L possibly damaging Het
Rab3gap2 T A 1: 184,954,056 (GRCm39) W43R probably damaging Het
Repin1 A G 6: 48,573,464 (GRCm39) Q128R probably benign Het
Rnf208 G A 2: 25,133,656 (GRCm39) V117I probably damaging Het
Rpe65 A G 3: 159,321,208 (GRCm39) Y340C probably damaging Het
Ryr1 C A 7: 28,719,166 (GRCm39) V4414L unknown Het
Sephs2 T C 7: 126,872,649 (GRCm39) E148G possibly damaging Het
Spns2 T A 11: 72,348,094 (GRCm39) Q291L probably benign Het
Ssc5d C T 7: 4,946,915 (GRCm39) P1090S probably benign Het
Tasp1 A T 2: 139,793,426 (GRCm39) V250D probably damaging Het
Tg T C 15: 66,555,747 (GRCm39) V813A probably benign Het
Tmem132c T C 5: 127,581,988 (GRCm39) L401P probably benign Het
Tmem138 T C 19: 10,548,967 (GRCm39) N101S probably benign Het
Tmem242 G T 17: 5,483,745 (GRCm39) A99E probably damaging Het
Tmem30a C T 9: 79,681,446 (GRCm39) R277H probably benign Het
Tmt1a A T 15: 100,211,049 (GRCm39) I174F probably benign Het
Tnni3 T A 7: 4,522,405 (GRCm39) I182F probably benign Het
Trim30a T A 7: 104,060,711 (GRCm39) D355V probably damaging Het
Trim35 C T 14: 66,546,711 (GRCm39) R493* probably null Het
Trip10 G C 17: 57,562,135 (GRCm39) V254L probably benign Het
Tshz2 A T 2: 169,728,326 (GRCm39) Q505L probably benign Het
Ttyh1 T C 7: 4,131,183 (GRCm39) V218A probably damaging Het
Unc13b A T 4: 43,182,780 (GRCm39) E3163V possibly damaging Het
Unc45b T A 11: 82,808,625 (GRCm39) M237K probably benign Het
Usp8 A G 2: 126,600,488 (GRCm39) T1080A probably benign Het
Vmn2r65 T A 7: 84,590,119 (GRCm39) H599L possibly damaging Het
Vps13c A G 9: 67,861,142 (GRCm39) N2891S probably benign Het
Xpo5 C T 17: 46,551,822 (GRCm39) Q1050* probably null Het
Zfp407 G T 18: 84,227,918 (GRCm39) T1897K probably damaging Het
Zzef1 C T 11: 72,791,459 (GRCm39) R2188* probably null Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGATGTGGCTTCCCCAGC -3'
(R):5'- GTGGTCTACAGTTGAAGGTCTAC -3'

Sequencing Primer
(F):5'- CCATCAAATTATGTCAGGTGGATGG -3'
(R):5'- GGCCAAGCTAGGTAACT -3'
Posted On 2014-10-16