Incidental Mutation 'R2259:Ttyh1'
ID243627
Institutional Source Beutler Lab
Gene Symbol Ttyh1
Ensembl Gene ENSMUSG00000030428
Gene Nametweety family member 1
Synonyms6330408P11Rik, tty, 4930459B04Rik
MMRRC Submission 040259-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2259 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4119408-4136708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4128184 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 218 (V218A)
Ref Sequence ENSEMBL: ENSMUSP00000120182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032594] [ENSMUST00000079415] [ENSMUST00000119661] [ENSMUST00000129423] [ENSMUST00000153673] [ENSMUST00000206869] [ENSMUST00000206987]
Predicted Effect probably benign
Transcript: ENSMUST00000032594
SMART Domains Protein: ENSMUSP00000032594
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 1 72 4.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079415
AA Change: V218A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078384
Gene: ENSMUSG00000030428
AA Change: V218A

DomainStartEndE-ValueType
Pfam:Tweety 26 428 3.2e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119661
AA Change: V218A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113937
Gene: ENSMUSG00000030428
AA Change: V218A

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128317
Predicted Effect probably damaging
Transcript: ENSMUST00000129423
AA Change: V218A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120182
Gene: ENSMUSG00000030428
AA Change: V218A

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151959
Predicted Effect probably benign
Transcript: ENSMUST00000153673
SMART Domains Protein: ENSMUSP00000115623
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 26 103 1.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205971
Predicted Effect possibly damaging
Transcript: ENSMUST00000206869
AA Change: V122A

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000206987
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Tweety family of membrane proteins. Members of this family contain five predicted transmembrane regions that are arranged in a characteristic pattern. In mouse, the protein is predominantly localized to the endoplasmic reticulum and displays calcium binding activity. Targeted knock out of this gene results in early embryonic lethality prior to the blastocyst stage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with arrest before the blastocyst stage and mitotic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,112,311 S91A possibly damaging Het
Ankrd13b T G 11: 77,476,342 N247T probably damaging Het
Atp10b A G 11: 43,172,745 D169G probably damaging Het
Atp10b G A 11: 43,189,613 V239M probably damaging Het
Cflar C T 1: 58,729,121 T121I probably benign Het
Clca3b T C 3: 144,846,381 N180D possibly damaging Het
Cnbd2 T A 2: 156,335,272 I62N probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Cyp2a4 C T 7: 26,309,035 L201F probably damaging Het
D630003M21Rik A T 2: 158,204,711 L782Q probably damaging Het
Dctn1 C A 6: 83,197,586 H1065N possibly damaging Het
Dgcr2 A T 16: 17,844,977 probably null Het
Dlg4 T C 11: 70,031,370 I143T probably damaging Het
E2f7 T G 10: 110,746,343 N4K probably damaging Het
Eef2kmt C T 16: 5,245,308 V323I probably benign Het
Eif2ak4 A C 2: 118,455,783 I1017L probably damaging Het
Eln C A 5: 134,729,654 A126S unknown Het
Exoc7 T C 11: 116,306,411 S35G probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam196a T A 7: 134,917,667 E378V probably damaging Het
Fkbp6 C T 5: 135,337,614 probably null Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fmn2 T A 1: 174,502,932 L296H unknown Het
Galnt14 C A 17: 73,494,266 M520I probably benign Het
Gba2 A G 4: 43,570,107 C396R probably benign Het
Gigyf1 C A 5: 137,520,332 A215E possibly damaging Het
Glb1 C T 9: 114,443,032 Q246* probably null Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gpr160 A G 3: 30,896,295 Y172C probably damaging Het
Ift52 A G 2: 163,028,093 N159S probably benign Het
Insrr A G 3: 87,800,452 D67G probably damaging Het
Irf2 A G 8: 46,837,833 Y230C probably benign Het
Jmjd6 T C 11: 116,841,314 H187R probably damaging Het
Kdm2b C T 5: 122,882,416 G90S probably damaging Het
Kif7 C T 7: 79,711,589 G118D probably damaging Het
Klhl38 G C 15: 58,314,978 T532S possibly damaging Het
Kmt2a G T 9: 44,881,142 probably benign Het
Lama2 A G 10: 27,031,127 L2346S probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo7a T G 7: 98,069,499 D1388A probably damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Ncoa1 A C 12: 4,315,819 H82Q probably damaging Het
Npbwr1 C A 1: 5,916,658 L212F probably damaging Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Npy2r G T 3: 82,541,354 P38Q possibly damaging Het
Ocln A T 13: 100,535,029 D24E probably damaging Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr295 T A 7: 86,585,884 V203D possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Phf3 A G 1: 30,804,343 V1845A probably benign Het
Plch1 T A 3: 63,697,977 Q1493L possibly damaging Het
Pold1 T C 7: 44,541,484 probably benign Het
Polq T C 16: 37,062,097 V1541A probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Pura T C 18: 36,287,750 F197L possibly damaging Het
Rab3gap2 T A 1: 185,221,859 W43R probably damaging Het
Repin1 A G 6: 48,596,530 Q128R probably benign Het
Rnf208 G A 2: 25,243,644 V117I probably damaging Het
Rpe65 A G 3: 159,615,571 Y340C probably damaging Het
Ryr1 C A 7: 29,019,741 V4414L unknown Het
Sephs2 T C 7: 127,273,477 E148G possibly damaging Het
Spns2 T A 11: 72,457,268 Q291L probably benign Het
Ssc5d C T 7: 4,943,916 P1090S probably benign Het
Tasp1 A T 2: 139,951,506 V250D probably damaging Het
Tcaf3 A G 6: 42,591,430 I664T possibly damaging Het
Tg T C 15: 66,683,898 V813A probably benign Het
Tmem132c T C 5: 127,504,924 L401P probably benign Het
Tmem138 T C 19: 10,571,603 N101S probably benign Het
Tmem242 G T 17: 5,433,470 A99E probably damaging Het
Tmem30a C T 9: 79,774,164 R277H probably benign Het
Tnni3 T A 7: 4,519,406 I182F probably benign Het
Trim30a T A 7: 104,411,504 D355V probably damaging Het
Trim35 C T 14: 66,309,262 R493* probably null Het
Trip10 G C 17: 57,255,135 V254L probably benign Het
Tshz2 A T 2: 169,886,406 Q505L probably benign Het
Unc13b A T 4: 43,182,780 E3163V possibly damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Usp8 A G 2: 126,758,568 T1080A probably benign Het
Vmn2r65 T A 7: 84,940,911 H599L possibly damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zfp407 G T 18: 84,209,793 T1897K probably damaging Het
Zzef1 C T 11: 72,900,633 R2188* probably null Het
Other mutations in Ttyh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ttyh1 APN 7 4124657 missense probably damaging 1.00
IGL01730:Ttyh1 APN 7 4125721 missense possibly damaging 0.90
IGL02052:Ttyh1 APN 7 4130574 unclassified probably benign
IGL02410:Ttyh1 APN 7 4133899 utr 3 prime probably benign
IGL02651:Ttyh1 APN 7 4124679 missense probably damaging 1.00
PIT4468001:Ttyh1 UTSW 7 4119772 missense possibly damaging 0.49
R0137:Ttyh1 UTSW 7 4124720 missense possibly damaging 0.95
R1699:Ttyh1 UTSW 7 4119696 missense possibly damaging 0.79
R1739:Ttyh1 UTSW 7 4129349 missense probably benign 0.18
R1865:Ttyh1 UTSW 7 4119731 missense probably damaging 1.00
R2258:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R2260:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R3027:Ttyh1 UTSW 7 4119722 missense probably benign 0.31
R3426:Ttyh1 UTSW 7 4133219 critical splice donor site probably null
R3939:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R3941:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R4328:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4329:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4527:Ttyh1 UTSW 7 4119764 missense probably damaging 1.00
R4849:Ttyh1 UTSW 7 4122534 missense possibly damaging 0.84
R4898:Ttyh1 UTSW 7 4133736 missense probably benign 0.03
R4931:Ttyh1 UTSW 7 4133944 utr 3 prime probably benign
R4960:Ttyh1 UTSW 7 4128226 missense probably damaging 1.00
R6158:Ttyh1 UTSW 7 4125562 missense probably benign 0.00
R6362:Ttyh1 UTSW 7 4129324 missense possibly damaging 0.67
R6799:Ttyh1 UTSW 7 4133222 splice site probably null
R6823:Ttyh1 UTSW 7 4122529 missense probably damaging 0.97
R6897:Ttyh1 UTSW 7 4124650 utr 3 prime probably benign
R7070:Ttyh1 UTSW 7 4133364 missense probably damaging 0.99
R7236:Ttyh1 UTSW 7 4133664 missense probably benign 0.00
R7287:Ttyh1 UTSW 7 4125658 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGCTTCAGTTCCACACCCATG -3'
(R):5'- ACGTGTGGCATGTCAGAGAC -3'

Sequencing Primer
(F):5'- GTTCCACACCCATGCTGCAG -3'
(R):5'- TCCCGAGCCCTTTATAGCAAATG -3'
Posted On2014-10-16