Incidental Mutation 'R2259:Or5bw2'
ID 243630
Institutional Source Beutler Lab
Gene Symbol Or5bw2
Ensembl Gene ENSMUSG00000056696
Gene Name olfactory receptor family 5 subfamily BW member 2
Synonyms GA_x6K02T2QGBW-3300391-3301317, MOR222-3, Olfr1350
MMRRC Submission 040259-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R2259 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 6572992-6573918 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 6573022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 11 (I11F)
Ref Sequence ENSEMBL: ENSMUSP00000151318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070985] [ENSMUST00000207221] [ENSMUST00000219278]
AlphaFold Q8VF34
Predicted Effect probably damaging
Transcript: ENSMUST00000070985
AA Change: I11F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069927
Gene: ENSMUSG00000056696
AA Change: I11F

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-50 PFAM
Pfam:7tm_1 39 288 8.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207221
AA Change: I11F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219278
AA Change: I11F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,189,375 (GRCm39) S91A possibly damaging Het
Ankrd13b T G 11: 77,367,168 (GRCm39) N247T probably damaging Het
Atp10b A G 11: 43,063,572 (GRCm39) D169G probably damaging Het
Atp10b G A 11: 43,080,440 (GRCm39) V239M probably damaging Het
Cflar C T 1: 58,768,280 (GRCm39) T121I probably benign Het
Clca3b T C 3: 144,552,142 (GRCm39) N180D possibly damaging Het
Cnbd2 T A 2: 156,177,192 (GRCm39) I62N probably damaging Het
Col11a2 A G 17: 34,258,651 (GRCm39) H8R probably benign Het
Cyp2a4 C T 7: 26,008,460 (GRCm39) L201F probably damaging Het
D630003M21Rik A T 2: 158,046,631 (GRCm39) L782Q probably damaging Het
Dctn1 C A 6: 83,174,568 (GRCm39) H1065N possibly damaging Het
Dgcr2 A T 16: 17,662,841 (GRCm39) probably null Het
Dlg4 T C 11: 69,922,196 (GRCm39) I143T probably damaging Het
E2f7 T G 10: 110,582,204 (GRCm39) N4K probably damaging Het
Eef2kmt C T 16: 5,063,172 (GRCm39) V323I probably benign Het
Eif2ak4 A C 2: 118,286,264 (GRCm39) I1017L probably damaging Het
Eln C A 5: 134,758,508 (GRCm39) A126S unknown Het
Exoc7 T C 11: 116,197,237 (GRCm39) S35G probably damaging Het
Fam187a A G 11: 102,776,124 (GRCm39) probably benign Het
Fkbp6 C T 5: 135,366,468 (GRCm39) probably null Het
Flnc G A 6: 29,438,665 (GRCm39) W186* probably null Het
Fmn2 T A 1: 174,330,498 (GRCm39) L296H unknown Het
Galnt14 C A 17: 73,801,261 (GRCm39) M520I probably benign Het
Gba2 A G 4: 43,570,107 (GRCm39) C396R probably benign Het
Gigyf1 C A 5: 137,518,594 (GRCm39) A215E possibly damaging Het
Glb1 C T 9: 114,272,100 (GRCm39) Q246* probably null Het
Gm11565 T G 11: 99,805,844 (GRCm39) C79G possibly damaging Het
Gpr160 A G 3: 30,950,444 (GRCm39) Y172C probably damaging Het
Ift52 A G 2: 162,870,013 (GRCm39) N159S probably benign Het
Insrr A G 3: 87,707,759 (GRCm39) D67G probably damaging Het
Insyn2a T A 7: 134,519,396 (GRCm39) E378V probably damaging Het
Irf2 A G 8: 47,290,868 (GRCm39) Y230C probably benign Het
Jmjd6 T C 11: 116,732,140 (GRCm39) H187R probably damaging Het
Kdm2b C T 5: 123,020,479 (GRCm39) G90S probably damaging Het
Kif7 C T 7: 79,361,337 (GRCm39) G118D probably damaging Het
Klhl38 G C 15: 58,178,374 (GRCm39) T532S possibly damaging Het
Kmt2a G T 9: 44,792,440 (GRCm39) probably benign Het
Lama2 A G 10: 26,907,123 (GRCm39) L2346S probably benign Het
Marveld2 A G 13: 100,748,978 (GRCm39) S34P probably benign Het
Mllt6 T C 11: 97,555,802 (GRCm39) V44A probably damaging Het
Muc5ac A G 7: 141,344,745 (GRCm39) N72S probably benign Het
Myo7a T G 7: 97,718,706 (GRCm39) D1388A probably damaging Het
Ncapd3 A G 9: 26,967,368 (GRCm39) D568G probably benign Het
Ncoa1 A C 12: 4,365,819 (GRCm39) H82Q probably damaging Het
Npbwr1 C A 1: 5,986,877 (GRCm39) L212F probably damaging Het
Nptx1 T G 11: 119,434,142 (GRCm39) I315L probably benign Het
Npy2r G T 3: 82,448,661 (GRCm39) P38Q possibly damaging Het
Ocln A T 13: 100,671,537 (GRCm39) D24E probably damaging Het
Or14c41 T A 7: 86,235,092 (GRCm39) V203D possibly damaging Het
Or8d1b T C 9: 38,887,296 (GRCm39) V108A probably benign Het
Pde2a A T 7: 101,133,774 (GRCm39) D85V probably damaging Het
Phf3 A G 1: 30,843,424 (GRCm39) V1845A probably benign Het
Plch1 T A 3: 63,605,398 (GRCm39) Q1493L possibly damaging Het
Pold1 T C 7: 44,190,908 (GRCm39) probably benign Het
Polq T C 16: 36,882,459 (GRCm39) V1541A probably benign Het
Psmd3 T A 11: 98,581,790 (GRCm39) M305K probably benign Het
Pura T C 18: 36,420,803 (GRCm39) F197L possibly damaging Het
Rab3gap2 T A 1: 184,954,056 (GRCm39) W43R probably damaging Het
Repin1 A G 6: 48,573,464 (GRCm39) Q128R probably benign Het
Rnf208 G A 2: 25,133,656 (GRCm39) V117I probably damaging Het
Rpe65 A G 3: 159,321,208 (GRCm39) Y340C probably damaging Het
Ryr1 C A 7: 28,719,166 (GRCm39) V4414L unknown Het
Sephs2 T C 7: 126,872,649 (GRCm39) E148G possibly damaging Het
Spns2 T A 11: 72,348,094 (GRCm39) Q291L probably benign Het
Ssc5d C T 7: 4,946,915 (GRCm39) P1090S probably benign Het
Tasp1 A T 2: 139,793,426 (GRCm39) V250D probably damaging Het
Tcaf3 A G 6: 42,568,364 (GRCm39) I664T possibly damaging Het
Tg T C 15: 66,555,747 (GRCm39) V813A probably benign Het
Tmem132c T C 5: 127,581,988 (GRCm39) L401P probably benign Het
Tmem138 T C 19: 10,548,967 (GRCm39) N101S probably benign Het
Tmem242 G T 17: 5,483,745 (GRCm39) A99E probably damaging Het
Tmem30a C T 9: 79,681,446 (GRCm39) R277H probably benign Het
Tmt1a A T 15: 100,211,049 (GRCm39) I174F probably benign Het
Tnni3 T A 7: 4,522,405 (GRCm39) I182F probably benign Het
Trim30a T A 7: 104,060,711 (GRCm39) D355V probably damaging Het
Trim35 C T 14: 66,546,711 (GRCm39) R493* probably null Het
Trip10 G C 17: 57,562,135 (GRCm39) V254L probably benign Het
Tshz2 A T 2: 169,728,326 (GRCm39) Q505L probably benign Het
Ttyh1 T C 7: 4,131,183 (GRCm39) V218A probably damaging Het
Unc13b A T 4: 43,182,780 (GRCm39) E3163V possibly damaging Het
Unc45b T A 11: 82,808,625 (GRCm39) M237K probably benign Het
Usp8 A G 2: 126,600,488 (GRCm39) T1080A probably benign Het
Vmn2r65 T A 7: 84,590,119 (GRCm39) H599L possibly damaging Het
Vps13c A G 9: 67,861,142 (GRCm39) N2891S probably benign Het
Xpo5 C T 17: 46,551,822 (GRCm39) Q1050* probably null Het
Zfp407 G T 18: 84,227,918 (GRCm39) T1897K probably damaging Het
Zzef1 C T 11: 72,791,459 (GRCm39) R2188* probably null Het
Other mutations in Or5bw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Or5bw2 APN 7 6,573,667 (GRCm39) missense possibly damaging 0.88
IGL01387:Or5bw2 APN 7 6,573,854 (GRCm39) missense probably damaging 1.00
IGL01457:Or5bw2 APN 7 6,573,211 (GRCm39) missense probably benign 0.12
IGL01568:Or5bw2 APN 7 6,573,569 (GRCm39) missense possibly damaging 0.91
I2288:Or5bw2 UTSW 7 6,573,818 (GRCm39) missense probably damaging 1.00
I2289:Or5bw2 UTSW 7 6,573,818 (GRCm39) missense probably damaging 1.00
R0454:Or5bw2 UTSW 7 6,573,359 (GRCm39) missense probably damaging 1.00
R0558:Or5bw2 UTSW 7 6,573,652 (GRCm39) missense possibly damaging 0.77
R1103:Or5bw2 UTSW 7 6,573,111 (GRCm39) missense probably damaging 1.00
R1352:Or5bw2 UTSW 7 6,573,782 (GRCm39) missense probably benign 0.11
R1503:Or5bw2 UTSW 7 6,573,470 (GRCm39) missense probably damaging 1.00
R1630:Or5bw2 UTSW 7 6,573,673 (GRCm39) missense probably damaging 1.00
R1981:Or5bw2 UTSW 7 6,573,557 (GRCm39) missense probably benign 0.01
R2228:Or5bw2 UTSW 7 6,573,802 (GRCm39) missense probably benign
R2258:Or5bw2 UTSW 7 6,573,022 (GRCm39) missense probably damaging 0.98
R2260:Or5bw2 UTSW 7 6,573,022 (GRCm39) missense probably damaging 0.98
R4075:Or5bw2 UTSW 7 6,573,142 (GRCm39) missense probably benign 0.00
R4750:Or5bw2 UTSW 7 6,573,850 (GRCm39) missense probably benign 0.34
R4917:Or5bw2 UTSW 7 6,573,643 (GRCm39) missense possibly damaging 0.88
R4918:Or5bw2 UTSW 7 6,573,643 (GRCm39) missense possibly damaging 0.88
R5571:Or5bw2 UTSW 7 6,573,824 (GRCm39) missense possibly damaging 0.95
R5915:Or5bw2 UTSW 7 6,573,172 (GRCm39) missense probably benign 0.31
R6969:Or5bw2 UTSW 7 6,573,320 (GRCm39) missense probably damaging 1.00
R7061:Or5bw2 UTSW 7 6,573,782 (GRCm39) missense probably damaging 1.00
R7286:Or5bw2 UTSW 7 6,573,715 (GRCm39) missense probably damaging 1.00
R7510:Or5bw2 UTSW 7 6,572,960 (GRCm39) start gained probably benign
R9475:Or5bw2 UTSW 7 6,573,818 (GRCm39) missense probably damaging 1.00
V1662:Or5bw2 UTSW 7 6,573,818 (GRCm39) missense probably damaging 1.00
Z1176:Or5bw2 UTSW 7 6,573,047 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCCAAAGGCAACAAATTGT -3'
(R):5'- TCCACTAGGGAGAGGTGTTTGA -3'

Sequencing Primer
(F):5'- TGTGCAACAGCCATGTCATG -3'
(R):5'- CCACTAGGGAGAGGTGTTTGATGAAG -3'
Posted On 2014-10-16