Incidental Mutation 'R2259:Atp10b'
ID 243656
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene Name ATPase, class V, type 10B
Synonyms 9030605H24Rik, 5930426O13Rik
MMRRC Submission 040259-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R2259 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 43040704-43153112 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43063572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 169 (D169G)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
AlphaFold B1AWN4
Predicted Effect probably damaging
Transcript: ENSMUST00000077659
AA Change: D169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: D169G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137991
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,189,375 (GRCm39) S91A possibly damaging Het
Ankrd13b T G 11: 77,367,168 (GRCm39) N247T probably damaging Het
Cflar C T 1: 58,768,280 (GRCm39) T121I probably benign Het
Clca3b T C 3: 144,552,142 (GRCm39) N180D possibly damaging Het
Cnbd2 T A 2: 156,177,192 (GRCm39) I62N probably damaging Het
Col11a2 A G 17: 34,258,651 (GRCm39) H8R probably benign Het
Cyp2a4 C T 7: 26,008,460 (GRCm39) L201F probably damaging Het
D630003M21Rik A T 2: 158,046,631 (GRCm39) L782Q probably damaging Het
Dctn1 C A 6: 83,174,568 (GRCm39) H1065N possibly damaging Het
Dgcr2 A T 16: 17,662,841 (GRCm39) probably null Het
Dlg4 T C 11: 69,922,196 (GRCm39) I143T probably damaging Het
E2f7 T G 10: 110,582,204 (GRCm39) N4K probably damaging Het
Eef2kmt C T 16: 5,063,172 (GRCm39) V323I probably benign Het
Eif2ak4 A C 2: 118,286,264 (GRCm39) I1017L probably damaging Het
Eln C A 5: 134,758,508 (GRCm39) A126S unknown Het
Exoc7 T C 11: 116,197,237 (GRCm39) S35G probably damaging Het
Fam187a A G 11: 102,776,124 (GRCm39) probably benign Het
Fkbp6 C T 5: 135,366,468 (GRCm39) probably null Het
Flnc G A 6: 29,438,665 (GRCm39) W186* probably null Het
Fmn2 T A 1: 174,330,498 (GRCm39) L296H unknown Het
Galnt14 C A 17: 73,801,261 (GRCm39) M520I probably benign Het
Gba2 A G 4: 43,570,107 (GRCm39) C396R probably benign Het
Gigyf1 C A 5: 137,518,594 (GRCm39) A215E possibly damaging Het
Glb1 C T 9: 114,272,100 (GRCm39) Q246* probably null Het
Gm11565 T G 11: 99,805,844 (GRCm39) C79G possibly damaging Het
Gpr160 A G 3: 30,950,444 (GRCm39) Y172C probably damaging Het
Ift52 A G 2: 162,870,013 (GRCm39) N159S probably benign Het
Insrr A G 3: 87,707,759 (GRCm39) D67G probably damaging Het
Insyn2a T A 7: 134,519,396 (GRCm39) E378V probably damaging Het
Irf2 A G 8: 47,290,868 (GRCm39) Y230C probably benign Het
Jmjd6 T C 11: 116,732,140 (GRCm39) H187R probably damaging Het
Kdm2b C T 5: 123,020,479 (GRCm39) G90S probably damaging Het
Kif7 C T 7: 79,361,337 (GRCm39) G118D probably damaging Het
Klhl38 G C 15: 58,178,374 (GRCm39) T532S possibly damaging Het
Kmt2a G T 9: 44,792,440 (GRCm39) probably benign Het
Lama2 A G 10: 26,907,123 (GRCm39) L2346S probably benign Het
Marveld2 A G 13: 100,748,978 (GRCm39) S34P probably benign Het
Mllt6 T C 11: 97,555,802 (GRCm39) V44A probably damaging Het
Muc5ac A G 7: 141,344,745 (GRCm39) N72S probably benign Het
Myo7a T G 7: 97,718,706 (GRCm39) D1388A probably damaging Het
Ncapd3 A G 9: 26,967,368 (GRCm39) D568G probably benign Het
Ncoa1 A C 12: 4,365,819 (GRCm39) H82Q probably damaging Het
Npbwr1 C A 1: 5,986,877 (GRCm39) L212F probably damaging Het
Nptx1 T G 11: 119,434,142 (GRCm39) I315L probably benign Het
Npy2r G T 3: 82,448,661 (GRCm39) P38Q possibly damaging Het
Ocln A T 13: 100,671,537 (GRCm39) D24E probably damaging Het
Or14c41 T A 7: 86,235,092 (GRCm39) V203D possibly damaging Het
Or5bw2 A T 7: 6,573,022 (GRCm39) I11F probably damaging Het
Or8d1b T C 9: 38,887,296 (GRCm39) V108A probably benign Het
Pde2a A T 7: 101,133,774 (GRCm39) D85V probably damaging Het
Phf3 A G 1: 30,843,424 (GRCm39) V1845A probably benign Het
Plch1 T A 3: 63,605,398 (GRCm39) Q1493L possibly damaging Het
Pold1 T C 7: 44,190,908 (GRCm39) probably benign Het
Polq T C 16: 36,882,459 (GRCm39) V1541A probably benign Het
Psmd3 T A 11: 98,581,790 (GRCm39) M305K probably benign Het
Pura T C 18: 36,420,803 (GRCm39) F197L possibly damaging Het
Rab3gap2 T A 1: 184,954,056 (GRCm39) W43R probably damaging Het
Repin1 A G 6: 48,573,464 (GRCm39) Q128R probably benign Het
Rnf208 G A 2: 25,133,656 (GRCm39) V117I probably damaging Het
Rpe65 A G 3: 159,321,208 (GRCm39) Y340C probably damaging Het
Ryr1 C A 7: 28,719,166 (GRCm39) V4414L unknown Het
Sephs2 T C 7: 126,872,649 (GRCm39) E148G possibly damaging Het
Spns2 T A 11: 72,348,094 (GRCm39) Q291L probably benign Het
Ssc5d C T 7: 4,946,915 (GRCm39) P1090S probably benign Het
Tasp1 A T 2: 139,793,426 (GRCm39) V250D probably damaging Het
Tcaf3 A G 6: 42,568,364 (GRCm39) I664T possibly damaging Het
Tg T C 15: 66,555,747 (GRCm39) V813A probably benign Het
Tmem132c T C 5: 127,581,988 (GRCm39) L401P probably benign Het
Tmem138 T C 19: 10,548,967 (GRCm39) N101S probably benign Het
Tmem242 G T 17: 5,483,745 (GRCm39) A99E probably damaging Het
Tmem30a C T 9: 79,681,446 (GRCm39) R277H probably benign Het
Tmt1a A T 15: 100,211,049 (GRCm39) I174F probably benign Het
Tnni3 T A 7: 4,522,405 (GRCm39) I182F probably benign Het
Trim30a T A 7: 104,060,711 (GRCm39) D355V probably damaging Het
Trim35 C T 14: 66,546,711 (GRCm39) R493* probably null Het
Trip10 G C 17: 57,562,135 (GRCm39) V254L probably benign Het
Tshz2 A T 2: 169,728,326 (GRCm39) Q505L probably benign Het
Ttyh1 T C 7: 4,131,183 (GRCm39) V218A probably damaging Het
Unc13b A T 4: 43,182,780 (GRCm39) E3163V possibly damaging Het
Unc45b T A 11: 82,808,625 (GRCm39) M237K probably benign Het
Usp8 A G 2: 126,600,488 (GRCm39) T1080A probably benign Het
Vmn2r65 T A 7: 84,590,119 (GRCm39) H599L possibly damaging Het
Vps13c A G 9: 67,861,142 (GRCm39) N2891S probably benign Het
Xpo5 C T 17: 46,551,822 (GRCm39) Q1050* probably null Het
Zfp407 G T 18: 84,227,918 (GRCm39) T1897K probably damaging Het
Zzef1 C T 11: 72,791,459 (GRCm39) R2188* probably null Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43,092,988 (GRCm39) missense probably damaging 1.00
IGL01385:Atp10b APN 11 43,125,256 (GRCm39) missense probably damaging 1.00
IGL01524:Atp10b APN 11 43,150,672 (GRCm39) missense probably benign 0.18
IGL01575:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01588:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01590:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01832:Atp10b APN 11 43,125,262 (GRCm39) missense probably damaging 0.98
IGL01927:Atp10b APN 11 43,150,231 (GRCm39) splice site probably benign
IGL01933:Atp10b APN 11 43,085,457 (GRCm39) missense probably damaging 1.00
IGL02182:Atp10b APN 11 43,139,774 (GRCm39) missense probably damaging 1.00
IGL02215:Atp10b APN 11 43,085,492 (GRCm39) critical splice donor site probably null
IGL02216:Atp10b APN 11 43,150,616 (GRCm39) missense probably damaging 0.98
IGL02973:Atp10b APN 11 43,088,336 (GRCm39) missense probably damaging 1.00
IGL03012:Atp10b APN 11 43,085,482 (GRCm39) missense probably damaging 0.99
IGL03106:Atp10b APN 11 43,138,304 (GRCm39) missense probably benign 0.32
IGL03123:Atp10b APN 11 43,044,110 (GRCm39) missense probably benign 0.01
IGL03202:Atp10b APN 11 43,125,268 (GRCm39) critical splice donor site probably null
IGL03339:Atp10b APN 11 43,121,442 (GRCm39) missense probably null 0.71
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0281:Atp10b UTSW 11 43,044,131 (GRCm39) missense probably benign 0.00
R0379:Atp10b UTSW 11 43,145,141 (GRCm39) missense probably benign 0.05
R0380:Atp10b UTSW 11 43,116,424 (GRCm39) missense probably damaging 1.00
R0470:Atp10b UTSW 11 43,093,866 (GRCm39) missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1368:Atp10b UTSW 11 43,092,981 (GRCm39) missense probably damaging 1.00
R1370:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1413:Atp10b UTSW 11 43,121,391 (GRCm39) missense probably benign 0.00
R1502:Atp10b UTSW 11 43,121,174 (GRCm39) missense probably damaging 1.00
R1530:Atp10b UTSW 11 43,088,351 (GRCm39) missense probably benign 0.03
R1596:Atp10b UTSW 11 43,126,594 (GRCm39) missense probably damaging 1.00
R1675:Atp10b UTSW 11 43,116,475 (GRCm39) missense probably damaging 1.00
R1880:Atp10b UTSW 11 43,150,259 (GRCm39) missense probably damaging 1.00
R1938:Atp10b UTSW 11 43,121,245 (GRCm39) missense probably benign 0.00
R1986:Atp10b UTSW 11 43,063,595 (GRCm39) missense probably benign 0.12
R2081:Atp10b UTSW 11 43,092,955 (GRCm39) missense probably damaging 1.00
R2083:Atp10b UTSW 11 43,103,250 (GRCm39) missense probably benign 0.24
R2159:Atp10b UTSW 11 43,042,680 (GRCm39) missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43,125,207 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,080,440 (GRCm39) missense probably damaging 1.00
R3741:Atp10b UTSW 11 43,126,489 (GRCm39) missense probably damaging 1.00
R3942:Atp10b UTSW 11 43,063,581 (GRCm39) missense probably damaging 1.00
R3971:Atp10b UTSW 11 43,107,339 (GRCm39) missense probably damaging 1.00
R4007:Atp10b UTSW 11 43,150,679 (GRCm39) missense probably benign 0.04
R4050:Atp10b UTSW 11 43,150,363 (GRCm39) missense probably benign 0.00
R4078:Atp10b UTSW 11 43,044,110 (GRCm39) missense probably benign 0.01
R4567:Atp10b UTSW 11 43,088,384 (GRCm39) missense probably benign 0.03
R4651:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4652:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4667:Atp10b UTSW 11 43,138,345 (GRCm39) missense probably damaging 1.00
R4720:Atp10b UTSW 11 43,093,949 (GRCm39) missense probably benign
R4987:Atp10b UTSW 11 43,042,440 (GRCm39) utr 5 prime probably benign
R5232:Atp10b UTSW 11 43,093,006 (GRCm39) missense probably damaging 1.00
R5233:Atp10b UTSW 11 43,121,387 (GRCm39) missense probably benign 0.06
R5281:Atp10b UTSW 11 43,145,163 (GRCm39) missense probably damaging 0.97
R5307:Atp10b UTSW 11 43,103,302 (GRCm39) missense probably damaging 1.00
R5460:Atp10b UTSW 11 43,121,282 (GRCm39) missense probably benign 0.00
R5518:Atp10b UTSW 11 43,042,463 (GRCm39) missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43,136,252 (GRCm39) missense probably damaging 1.00
R5688:Atp10b UTSW 11 43,092,000 (GRCm39) missense probably benign 0.00
R5735:Atp10b UTSW 11 43,042,601 (GRCm39) missense probably benign 0.00
R6153:Atp10b UTSW 11 43,145,109 (GRCm39) missense probably damaging 1.00
R6251:Atp10b UTSW 11 43,126,573 (GRCm39) missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43,092,065 (GRCm39) missense probably benign 0.24
R6394:Atp10b UTSW 11 43,116,464 (GRCm39) missense probably damaging 1.00
R6492:Atp10b UTSW 11 43,109,784 (GRCm39) missense probably damaging 1.00
R6769:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6771:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6775:Atp10b UTSW 11 43,113,040 (GRCm39) missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43,136,291 (GRCm39) missense probably damaging 1.00
R7322:Atp10b UTSW 11 43,103,374 (GRCm39) missense probably damaging 1.00
R7367:Atp10b UTSW 11 43,138,328 (GRCm39) missense probably damaging 1.00
R7538:Atp10b UTSW 11 43,116,373 (GRCm39) missense probably benign 0.04
R7708:Atp10b UTSW 11 43,092,970 (GRCm39) missense probably damaging 1.00
R7787:Atp10b UTSW 11 43,150,700 (GRCm39) missense possibly damaging 0.91
R8145:Atp10b UTSW 11 43,092,949 (GRCm39) missense probably damaging 1.00
R8406:Atp10b UTSW 11 43,093,984 (GRCm39) missense probably benign 0.00
R8503:Atp10b UTSW 11 43,113,066 (GRCm39) missense possibly damaging 0.92
R8542:Atp10b UTSW 11 43,121,208 (GRCm39) missense probably benign 0.18
R8744:Atp10b UTSW 11 43,121,177 (GRCm39) missense probably damaging 1.00
R8815:Atp10b UTSW 11 43,093,978 (GRCm39) missense possibly damaging 0.63
R8833:Atp10b UTSW 11 43,112,986 (GRCm39) missense probably damaging 1.00
R8880:Atp10b UTSW 11 43,106,811 (GRCm39) missense probably benign
R8989:Atp10b UTSW 11 43,136,269 (GRCm39) nonsense probably null
R8998:Atp10b UTSW 11 43,150,726 (GRCm39) makesense probably null
R9255:Atp10b UTSW 11 43,107,148 (GRCm39) missense probably damaging 1.00
R9281:Atp10b UTSW 11 43,116,458 (GRCm39) missense probably benign 0.11
R9345:Atp10b UTSW 11 43,094,024 (GRCm39) missense probably damaging 0.99
R9357:Atp10b UTSW 11 43,150,711 (GRCm39) missense probably benign 0.18
R9393:Atp10b UTSW 11 43,063,608 (GRCm39) missense probably damaging 1.00
R9516:Atp10b UTSW 11 43,121,224 (GRCm39) missense probably benign 0.02
R9644:Atp10b UTSW 11 43,042,659 (GRCm39) missense probably damaging 1.00
R9747:Atp10b UTSW 11 43,088,339 (GRCm39) missense probably benign
Z1177:Atp10b UTSW 11 43,044,176 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGGAATAGACCTTTTACGAGTGG -3'
(R):5'- ACTTACCGGCTGTGAGAAGC -3'

Sequencing Primer
(F):5'- TCCAGGATACAGGGTATTACTGCC -3'
(R):5'- TGTGAGAAGCCCTTCACGAC -3'
Posted On 2014-10-16