Incidental Mutation 'R2259:Xpo5'
ID243687
Institutional Source Beutler Lab
Gene Symbol Xpo5
Ensembl Gene ENSMUSG00000067150
Gene Nameexportin 5
SynonymsExp5, 2700038C24Rik, 2410004H11Rik
MMRRC Submission 040259-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2259 (G1)
Quality Score150
Status Not validated
Chromosome17
Chromosomal Location46202855-46242299 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 46240896 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1050 (Q1050*)
Ref Sequence ENSEMBL: ENSMUSP00000084257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000087031] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
Predicted Effect probably benign
Transcript: ENSMUST00000087026
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087031
AA Change: Q1050*
SMART Domains Protein: ENSMUSP00000084257
Gene: ENSMUSG00000067150
AA Change: Q1050*

DomainStartEndE-ValueType
IBN_N 33 100 6.73e-3 SMART
Pfam:Xpo1 109 271 1.4e-34 PFAM
low complexity region 326 342 N/A INTRINSIC
low complexity region 770 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142706
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152583
Predicted Effect probably benign
Transcript: ENSMUST00000173232
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173349
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174392
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the karyopherin family that is required for the transport of small RNAs and double-stranded RNA-binding proteins from the nucleus to the cytoplasm. The encoded protein translocates cargo through the nuclear pore complex in a RanGTP-dependent process. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,112,311 S91A possibly damaging Het
Ankrd13b T G 11: 77,476,342 N247T probably damaging Het
Atp10b A G 11: 43,172,745 D169G probably damaging Het
Atp10b G A 11: 43,189,613 V239M probably damaging Het
Cflar C T 1: 58,729,121 T121I probably benign Het
Clca3b T C 3: 144,846,381 N180D possibly damaging Het
Cnbd2 T A 2: 156,335,272 I62N probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Cyp2a4 C T 7: 26,309,035 L201F probably damaging Het
D630003M21Rik A T 2: 158,204,711 L782Q probably damaging Het
Dctn1 C A 6: 83,197,586 H1065N possibly damaging Het
Dgcr2 A T 16: 17,844,977 probably null Het
Dlg4 T C 11: 70,031,370 I143T probably damaging Het
E2f7 T G 10: 110,746,343 N4K probably damaging Het
Eef2kmt C T 16: 5,245,308 V323I probably benign Het
Eif2ak4 A C 2: 118,455,783 I1017L probably damaging Het
Eln C A 5: 134,729,654 A126S unknown Het
Exoc7 T C 11: 116,306,411 S35G probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam196a T A 7: 134,917,667 E378V probably damaging Het
Fkbp6 C T 5: 135,337,614 probably null Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fmn2 T A 1: 174,502,932 L296H unknown Het
Galnt14 C A 17: 73,494,266 M520I probably benign Het
Gba2 A G 4: 43,570,107 C396R probably benign Het
Gigyf1 C A 5: 137,520,332 A215E possibly damaging Het
Glb1 C T 9: 114,443,032 Q246* probably null Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gpr160 A G 3: 30,896,295 Y172C probably damaging Het
Ift52 A G 2: 163,028,093 N159S probably benign Het
Insrr A G 3: 87,800,452 D67G probably damaging Het
Irf2 A G 8: 46,837,833 Y230C probably benign Het
Jmjd6 T C 11: 116,841,314 H187R probably damaging Het
Kdm2b C T 5: 122,882,416 G90S probably damaging Het
Kif7 C T 7: 79,711,589 G118D probably damaging Het
Klhl38 G C 15: 58,314,978 T532S possibly damaging Het
Kmt2a G T 9: 44,881,142 probably benign Het
Lama2 A G 10: 27,031,127 L2346S probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo7a T G 7: 98,069,499 D1388A probably damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Ncoa1 A C 12: 4,315,819 H82Q probably damaging Het
Npbwr1 C A 1: 5,916,658 L212F probably damaging Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Npy2r G T 3: 82,541,354 P38Q possibly damaging Het
Ocln A T 13: 100,535,029 D24E probably damaging Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr295 T A 7: 86,585,884 V203D possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Phf3 A G 1: 30,804,343 V1845A probably benign Het
Plch1 T A 3: 63,697,977 Q1493L possibly damaging Het
Pold1 T C 7: 44,541,484 probably benign Het
Polq T C 16: 37,062,097 V1541A probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Pura T C 18: 36,287,750 F197L possibly damaging Het
Rab3gap2 T A 1: 185,221,859 W43R probably damaging Het
Repin1 A G 6: 48,596,530 Q128R probably benign Het
Rnf208 G A 2: 25,243,644 V117I probably damaging Het
Rpe65 A G 3: 159,615,571 Y340C probably damaging Het
Ryr1 C A 7: 29,019,741 V4414L unknown Het
Sephs2 T C 7: 127,273,477 E148G possibly damaging Het
Spns2 T A 11: 72,457,268 Q291L probably benign Het
Ssc5d C T 7: 4,943,916 P1090S probably benign Het
Tasp1 A T 2: 139,951,506 V250D probably damaging Het
Tcaf3 A G 6: 42,591,430 I664T possibly damaging Het
Tg T C 15: 66,683,898 V813A probably benign Het
Tmem132c T C 5: 127,504,924 L401P probably benign Het
Tmem138 T C 19: 10,571,603 N101S probably benign Het
Tmem242 G T 17: 5,433,470 A99E probably damaging Het
Tmem30a C T 9: 79,774,164 R277H probably benign Het
Tnni3 T A 7: 4,519,406 I182F probably benign Het
Trim30a T A 7: 104,411,504 D355V probably damaging Het
Trim35 C T 14: 66,309,262 R493* probably null Het
Trip10 G C 17: 57,255,135 V254L probably benign Het
Tshz2 A T 2: 169,886,406 Q505L probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Unc13b A T 4: 43,182,780 E3163V possibly damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Usp8 A G 2: 126,758,568 T1080A probably benign Het
Vmn2r65 T A 7: 84,940,911 H599L possibly damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Zfp407 G T 18: 84,209,793 T1897K probably damaging Het
Zzef1 C T 11: 72,900,633 R2188* probably null Het
Other mutations in Xpo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Xpo5 APN 17 46225047 missense probably damaging 1.00
IGL00650:Xpo5 APN 17 46208246 missense probably damaging 1.00
IGL00785:Xpo5 APN 17 46204692 missense probably damaging 1.00
IGL01869:Xpo5 APN 17 46242207 missense possibly damaging 0.75
IGL01929:Xpo5 APN 17 46202929 missense probably benign 0.13
IGL02433:Xpo5 APN 17 46239520 missense probably damaging 0.99
IGL02550:Xpo5 APN 17 46229329 missense probably benign 0.16
IGL02637:Xpo5 APN 17 46235979 missense probably damaging 1.00
IGL02942:Xpo5 APN 17 46208133 missense probably damaging 0.99
IGL03004:Xpo5 APN 17 46207840 missense probably damaging 1.00
IGL03149:Xpo5 APN 17 46215814 splice site probably null
IGL03296:Xpo5 APN 17 46221394 nonsense probably null
fortify UTSW 17 46221421 missense probably benign 0.01
fortissimo UTSW 17 46235970 missense probably benign 0.36
PIT4403001:Xpo5 UTSW 17 46239569 missense probably benign 0.01
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0035:Xpo5 UTSW 17 46240175 missense probably benign
R0276:Xpo5 UTSW 17 46241507 missense probably damaging 1.00
R0626:Xpo5 UTSW 17 46221433 missense probably damaging 1.00
R0843:Xpo5 UTSW 17 46222650 splice site probably benign
R1440:Xpo5 UTSW 17 46207927 splice site probably benign
R1506:Xpo5 UTSW 17 46227888 missense probably benign 0.04
R1513:Xpo5 UTSW 17 46226980 missense probably benign 0.06
R2060:Xpo5 UTSW 17 46225091 missense probably damaging 1.00
R2258:Xpo5 UTSW 17 46240896 nonsense probably null
R2260:Xpo5 UTSW 17 46240896 nonsense probably null
R2263:Xpo5 UTSW 17 46230343 missense probably benign
R3016:Xpo5 UTSW 17 46220831 missense probably damaging 1.00
R3149:Xpo5 UTSW 17 46242247 synonymous probably null
R3150:Xpo5 UTSW 17 46242247 synonymous probably null
R4613:Xpo5 UTSW 17 46236963 missense probably benign
R4784:Xpo5 UTSW 17 46222717 missense possibly damaging 0.59
R4808:Xpo5 UTSW 17 46235970 missense probably benign 0.36
R4981:Xpo5 UTSW 17 46220817 missense probably damaging 0.99
R5159:Xpo5 UTSW 17 46217609 missense probably damaging 1.00
R5286:Xpo5 UTSW 17 46234480 missense probably benign
R5294:Xpo5 UTSW 17 46236922 missense probably benign 0.12
R5550:Xpo5 UTSW 17 46234492 missense possibly damaging 0.87
R5750:Xpo5 UTSW 17 46218630 critical splice donor site probably null
R5774:Xpo5 UTSW 17 46241846 nonsense probably null
R5921:Xpo5 UTSW 17 46221421 missense probably benign 0.01
R6165:Xpo5 UTSW 17 46235957 missense possibly damaging 0.53
R6576:Xpo5 UTSW 17 46240808 splice site probably null
R7244:Xpo5 UTSW 17 46214625 missense probably damaging 1.00
R7414:Xpo5 UTSW 17 46221369 missense probably benign
X0019:Xpo5 UTSW 17 46234544 missense probably benign 0.00
X0062:Xpo5 UTSW 17 46230266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTCTGTCCCGCATACAG -3'
(R):5'- TTGGGAAACTTGGTCAGACC -3'

Sequencing Primer
(F):5'- ACTTTGTAGACCAGACTGGC -3'
(R):5'- CTGTCTGTCCCTCAAAATAGAAAGG -3'
Posted On2014-10-16