Incidental Mutation 'R2260:Olfr1186'
ID243702
Institutional Source Beutler Lab
Gene Symbol Olfr1186
Ensembl Gene ENSMUSG00000082882
Gene Nameolfactory receptor 1186
SynonymsGA_x6K02T2Q125-50012960-50013871, MOR230-5
MMRRC Submission 040260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2260 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88518551-88526790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88526386 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 268 (V268I)
Ref Sequence ENSEMBL: ENSMUSP00000151114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075025] [ENSMUST00000121619] [ENSMUST00000215912] [ENSMUST00000216978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075025
AA Change: V268I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074542
Gene: ENSMUSG00000057735
AA Change: V268I

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 2.5e-51 PFAM
Pfam:7tm_1 38 284 4.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121619
AA Change: V268I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215912
AA Change: V268I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216978
AA Change: V268I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,216,917 N1252I probably damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Adgrv1 A T 13: 81,568,374 V840E probably damaging Het
Adnp2 A T 18: 80,128,449 M915K probably benign Het
Cd101 G C 3: 101,016,945 L393V possibly damaging Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdc37l1 A T 19: 29,007,048 K194N probably benign Het
Cep126 T C 9: 8,101,748 T262A possibly damaging Het
Chit1 A G 1: 134,151,127 S392G probably benign Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Dusp12 C T 1: 170,881,011 R120H probably damaging Het
Eln C A 5: 134,729,654 A126S unknown Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
Fkbp6 C T 5: 135,337,614 probably null Het
Ftcd T A 10: 76,588,059 probably null Het
Gdf10 T C 14: 33,932,277 L247P probably damaging Het
Gigyf1 C A 5: 137,520,332 A215E possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Itfg1 C T 8: 85,722,677 C576Y probably damaging Het
Lama1 G T 17: 67,737,507 A134S probably damaging Het
Larp4 T G 15: 99,997,396 F283L possibly damaging Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mettl18 T A 1: 163,996,825 D238E probably benign Het
Mfn1 G T 3: 32,563,426 E74* probably null Het
Mfn2 C A 4: 147,894,606 E90* probably null Het
Mill2 T A 7: 18,856,488 D164E probably benign Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nt5c1b A T 12: 10,374,965 R170S probably damaging Het
Olfr1333 T C 4: 118,830,162 I93V probably damaging Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pald1 G A 10: 61,352,971 R87W probably damaging Het
Paox T A 7: 140,134,054 Y242* probably null Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Pitrm1 C T 13: 6,560,125 T411I probably damaging Het
Pkd1l3 A G 8: 109,623,636 Q371R probably benign Het
Ptprk A G 10: 28,206,149 D38G possibly damaging Het
Rag2 G A 2: 101,630,238 E298K probably benign Het
Rbm12b2 G A 4: 12,095,061 R640H probably benign Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rims2 G T 15: 39,478,566 E604* probably null Het
Rin2 A G 2: 145,878,904 D719G probably damaging Het
Sash1 G A 10: 8,786,378 Q155* probably null Het
Tacr1 A T 6: 82,403,775 I56F probably damaging Het
Tbc1d4 G A 14: 101,494,411 T455M probably damaging Het
Tex24 C T 8: 27,344,855 T137I probably damaging Het
Tmem200a A C 10: 25,993,415 S319A probably benign Het
Tmem242 G T 17: 5,433,470 A99E probably damaging Het
Tmem30a C T 9: 79,774,164 R277H probably benign Het
Tmprss11f G A 5: 86,591,410 A4V probably benign Het
Triobp T G 15: 78,991,440 probably null Het
Tshz2 A T 2: 169,886,406 Q505L probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Vmn2r11 A T 5: 109,053,791 Y282* probably null Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Other mutations in Olfr1186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr1186 APN 2 88525760 missense possibly damaging 0.87
IGL01727:Olfr1186 APN 2 88525927 missense probably benign 0.03
IGL01790:Olfr1186 APN 2 88526423 missense probably damaging 0.99
IGL01868:Olfr1186 APN 2 88525715 missense possibly damaging 0.66
IGL03146:Olfr1186 APN 2 88526144 missense possibly damaging 0.90
IGL03378:Olfr1186 APN 2 88526154 nonsense probably null
R0053:Olfr1186 UTSW 2 88526163 missense probably damaging 1.00
R0829:Olfr1186 UTSW 2 88526228 missense probably damaging 1.00
R1210:Olfr1186 UTSW 2 88526276 missense possibly damaging 0.89
R1754:Olfr1186 UTSW 2 88525815 missense probably damaging 0.99
R3426:Olfr1186 UTSW 2 88525864 missense probably damaging 1.00
R3781:Olfr1186 UTSW 2 88526365 missense probably benign 0.23
R4737:Olfr1186 UTSW 2 88526225 missense probably damaging 1.00
R4908:Olfr1186 UTSW 2 88525910 missense probably damaging 1.00
R4932:Olfr1186 UTSW 2 88525735 missense probably benign 0.02
R5071:Olfr1186 UTSW 2 88526041 missense probably damaging 1.00
R5831:Olfr1186 UTSW 2 88526480 nonsense probably null
R6222:Olfr1186 UTSW 2 88499270 missense probably benign 0.34
R6370:Olfr1186 UTSW 2 88499368 nonsense probably null
R6802:Olfr1186 UTSW 2 88525597 missense probably benign 0.02
R6931:Olfr1186 UTSW 2 88526194 missense possibly damaging 0.50
R7044:Olfr1186 UTSW 2 88526486 missense probably benign
R7121:Olfr1186 UTSW 2 88525826 missense probably damaging 1.00
R7166:Olfr1186 UTSW 2 88525646 missense possibly damaging 0.89
R7387:Olfr1186 UTSW 2 88526400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTACGGTAAGTTTCATAGTACTGC -3'
(R):5'- AGTAAGCTATGTCACAGGTCCTAG -3'

Sequencing Primer
(F):5'- CGGTAAGTTTCATAGTACTGCTTATC -3'
(R):5'- GCTATGTCACAGGTCCTAGATTATTG -3'
Posted On2014-10-16