Incidental Mutation 'R2260:Itfg1'
ID243732
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
MMRRC Submission 040260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2260 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85722677 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 576 (C576Y)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably damaging
Transcript: ENSMUST00000034140
AA Change: C576Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: C576Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210604
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,216,917 N1252I probably damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Adgrv1 A T 13: 81,568,374 V840E probably damaging Het
Adnp2 A T 18: 80,128,449 M915K probably benign Het
Cd101 G C 3: 101,016,945 L393V possibly damaging Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdc37l1 A T 19: 29,007,048 K194N probably benign Het
Cep126 T C 9: 8,101,748 T262A possibly damaging Het
Chit1 A G 1: 134,151,127 S392G probably benign Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Dusp12 C T 1: 170,881,011 R120H probably damaging Het
Eln C A 5: 134,729,654 A126S unknown Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
Fkbp6 C T 5: 135,337,614 probably null Het
Ftcd T A 10: 76,588,059 probably null Het
Gdf10 T C 14: 33,932,277 L247P probably damaging Het
Gigyf1 C A 5: 137,520,332 A215E possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Lama1 G T 17: 67,737,507 A134S probably damaging Het
Larp4 T G 15: 99,997,396 F283L possibly damaging Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mettl18 T A 1: 163,996,825 D238E probably benign Het
Mfn1 G T 3: 32,563,426 E74* probably null Het
Mfn2 C A 4: 147,894,606 E90* probably null Het
Mill2 T A 7: 18,856,488 D164E probably benign Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nt5c1b A T 12: 10,374,965 R170S probably damaging Het
Olfr1186 G A 2: 88,526,386 V268I possibly damaging Het
Olfr1333 T C 4: 118,830,162 I93V probably damaging Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pald1 G A 10: 61,352,971 R87W probably damaging Het
Paox T A 7: 140,134,054 Y242* probably null Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Pitrm1 C T 13: 6,560,125 T411I probably damaging Het
Pkd1l3 A G 8: 109,623,636 Q371R probably benign Het
Ptprk A G 10: 28,206,149 D38G possibly damaging Het
Rag2 G A 2: 101,630,238 E298K probably benign Het
Rbm12b2 G A 4: 12,095,061 R640H probably benign Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rims2 G T 15: 39,478,566 E604* probably null Het
Rin2 A G 2: 145,878,904 D719G probably damaging Het
Sash1 G A 10: 8,786,378 Q155* probably null Het
Tacr1 A T 6: 82,403,775 I56F probably damaging Het
Tbc1d4 G A 14: 101,494,411 T455M probably damaging Het
Tex24 C T 8: 27,344,855 T137I probably damaging Het
Tmem200a A C 10: 25,993,415 S319A probably benign Het
Tmem242 G T 17: 5,433,470 A99E probably damaging Het
Tmem30a C T 9: 79,774,164 R277H probably benign Het
Tmprss11f G A 5: 86,591,410 A4V probably benign Het
Triobp T G 15: 78,991,440 probably null Het
Tshz2 A T 2: 169,886,406 Q505L probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Vmn2r11 A T 5: 109,053,791 Y282* probably null Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7912:Itfg1 UTSW 8 85764280 missense probably damaging 1.00
R7985:Itfg1 UTSW 8 85725568 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCACCTACCAGCTAAGTATTTG -3'
(R):5'- ACCGTGAGCACCTTAGAATCATC -3'

Sequencing Primer
(F):5'- ACTTTCTTTTCTTCTTTGTGTGGAGC -3'
(R):5'- TGAGCACCTTAGAATCATCAATATTC -3'
Posted On2014-10-16