Incidental Mutation 'R2260:Sash1'
ID243740
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission 040260-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2260 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 8786378 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 155 (Q155*)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect probably null
Transcript: ENSMUST00000015449
AA Change: Q155*
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: Q155*

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,216,917 N1252I probably damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Adgrv1 A T 13: 81,568,374 V840E probably damaging Het
Adnp2 A T 18: 80,128,449 M915K probably benign Het
Cd101 G C 3: 101,016,945 L393V possibly damaging Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdc37l1 A T 19: 29,007,048 K194N probably benign Het
Cep126 T C 9: 8,101,748 T262A possibly damaging Het
Chit1 A G 1: 134,151,127 S392G probably benign Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Dusp12 C T 1: 170,881,011 R120H probably damaging Het
Eln C A 5: 134,729,654 A126S unknown Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
Fkbp6 C T 5: 135,337,614 probably null Het
Ftcd T A 10: 76,588,059 probably null Het
Gdf10 T C 14: 33,932,277 L247P probably damaging Het
Gigyf1 C A 5: 137,520,332 A215E possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Itfg1 C T 8: 85,722,677 C576Y probably damaging Het
Lama1 G T 17: 67,737,507 A134S probably damaging Het
Larp4 T G 15: 99,997,396 F283L possibly damaging Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mettl18 T A 1: 163,996,825 D238E probably benign Het
Mfn1 G T 3: 32,563,426 E74* probably null Het
Mfn2 C A 4: 147,894,606 E90* probably null Het
Mill2 T A 7: 18,856,488 D164E probably benign Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nt5c1b A T 12: 10,374,965 R170S probably damaging Het
Olfr1186 G A 2: 88,526,386 V268I possibly damaging Het
Olfr1333 T C 4: 118,830,162 I93V probably damaging Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pald1 G A 10: 61,352,971 R87W probably damaging Het
Paox T A 7: 140,134,054 Y242* probably null Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Pitrm1 C T 13: 6,560,125 T411I probably damaging Het
Pkd1l3 A G 8: 109,623,636 Q371R probably benign Het
Ptprk A G 10: 28,206,149 D38G possibly damaging Het
Rag2 G A 2: 101,630,238 E298K probably benign Het
Rbm12b2 G A 4: 12,095,061 R640H probably benign Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rims2 G T 15: 39,478,566 E604* probably null Het
Rin2 A G 2: 145,878,904 D719G probably damaging Het
Tacr1 A T 6: 82,403,775 I56F probably damaging Het
Tbc1d4 G A 14: 101,494,411 T455M probably damaging Het
Tex24 C T 8: 27,344,855 T137I probably damaging Het
Tmem200a A C 10: 25,993,415 S319A probably benign Het
Tmem242 G T 17: 5,433,470 A99E probably damaging Het
Tmem30a C T 9: 79,774,164 R277H probably benign Het
Tmprss11f G A 5: 86,591,410 A4V probably benign Het
Triobp T G 15: 78,991,440 probably null Het
Tshz2 A T 2: 169,886,406 Q505L probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Vmn2r11 A T 5: 109,053,791 Y282* probably null Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R7939:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7984:Sash1 UTSW 10 8780564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTTGCAGACTTGGTCCCCG -3'
(R):5'- AGCTCTGACATTGTAAGAAAGAGAC -3'

Sequencing Primer
(F):5'- GTCAGAAGACCACTAGCTAGTCTAG -3'
(R):5'- GAATTTACTGCTTGTGTACCTC -3'
Posted On2014-10-16