Incidental Mutation 'R2260:Rims2'
ID243753
Institutional Source Beutler Lab
Gene Symbol Rims2
Ensembl Gene ENSMUSG00000037386
Gene Nameregulating synaptic membrane exocytosis 2
Synonyms2810036I15Rik, Syt3-rs, RIM2
MMRRC Submission 040260-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R2260 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location39198261-39684372 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 39478566 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 604 (E604*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]
Predicted Effect probably null
Transcript: ENSMUST00000042917
AA Change: E884*
SMART Domains Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: E884*

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 30 154 9.5e-18 PFAM
low complexity region 315 335 N/A INTRINSIC
low complexity region 492 498 N/A INTRINSIC
low complexity region 511 521 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
PDZ 646 725 8.27e-16 SMART
low complexity region 740 748 N/A INTRINSIC
C2 790 897 4.08e-21 SMART
low complexity region 905 919 N/A INTRINSIC
low complexity region 1085 1101 N/A INTRINSIC
low complexity region 1116 1130 N/A INTRINSIC
low complexity region 1208 1238 N/A INTRINSIC
C2 1432 1535 3.78e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000082054
AA Change: E924*
SMART Domains Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: E924*

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 76 194 2.2e-11 PFAM
low complexity region 355 375 N/A INTRINSIC
low complexity region 532 538 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
PDZ 686 765 8.27e-16 SMART
low complexity region 780 788 N/A INTRINSIC
C2 830 937 4.08e-21 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1166 1196 N/A INTRINSIC
C2 1390 1493 3.78e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000227243
AA Change: E884*
Predicted Effect probably null
Transcript: ENSMUST00000227381
AA Change: E604*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,216,917 N1252I probably damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Adgrv1 A T 13: 81,568,374 V840E probably damaging Het
Adnp2 A T 18: 80,128,449 M915K probably benign Het
Cd101 G C 3: 101,016,945 L393V possibly damaging Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdc37l1 A T 19: 29,007,048 K194N probably benign Het
Cep126 T C 9: 8,101,748 T262A possibly damaging Het
Chit1 A G 1: 134,151,127 S392G probably benign Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Dusp12 C T 1: 170,881,011 R120H probably damaging Het
Eln C A 5: 134,729,654 A126S unknown Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
Fkbp6 C T 5: 135,337,614 probably null Het
Ftcd T A 10: 76,588,059 probably null Het
Gdf10 T C 14: 33,932,277 L247P probably damaging Het
Gigyf1 C A 5: 137,520,332 A215E possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Itfg1 C T 8: 85,722,677 C576Y probably damaging Het
Lama1 G T 17: 67,737,507 A134S probably damaging Het
Larp4 T G 15: 99,997,396 F283L possibly damaging Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mettl18 T A 1: 163,996,825 D238E probably benign Het
Mfn1 G T 3: 32,563,426 E74* probably null Het
Mfn2 C A 4: 147,894,606 E90* probably null Het
Mill2 T A 7: 18,856,488 D164E probably benign Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nt5c1b A T 12: 10,374,965 R170S probably damaging Het
Olfr1186 G A 2: 88,526,386 V268I possibly damaging Het
Olfr1333 T C 4: 118,830,162 I93V probably damaging Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pald1 G A 10: 61,352,971 R87W probably damaging Het
Paox T A 7: 140,134,054 Y242* probably null Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Pitrm1 C T 13: 6,560,125 T411I probably damaging Het
Pkd1l3 A G 8: 109,623,636 Q371R probably benign Het
Ptprk A G 10: 28,206,149 D38G possibly damaging Het
Rag2 G A 2: 101,630,238 E298K probably benign Het
Rbm12b2 G A 4: 12,095,061 R640H probably benign Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rin2 A G 2: 145,878,904 D719G probably damaging Het
Sash1 G A 10: 8,786,378 Q155* probably null Het
Tacr1 A T 6: 82,403,775 I56F probably damaging Het
Tbc1d4 G A 14: 101,494,411 T455M probably damaging Het
Tex24 C T 8: 27,344,855 T137I probably damaging Het
Tmem200a A C 10: 25,993,415 S319A probably benign Het
Tmem242 G T 17: 5,433,470 A99E probably damaging Het
Tmem30a C T 9: 79,774,164 R277H probably benign Het
Tmprss11f G A 5: 86,591,410 A4V probably benign Het
Triobp T G 15: 78,991,440 probably null Het
Tshz2 A T 2: 169,886,406 Q505L probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Vmn2r11 A T 5: 109,053,791 Y282* probably null Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Other mutations in Rims2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Rims2 APN 15 39459615 missense probably benign 0.11
IGL00502:Rims2 APN 15 39506984 missense probably damaging 1.00
IGL00556:Rims2 APN 15 39456674 splice site probably null
IGL00811:Rims2 APN 15 39292149 missense probably damaging 1.00
IGL00827:Rims2 APN 15 39472359 missense probably damaging 0.99
IGL01642:Rims2 APN 15 39457796 missense probably damaging 1.00
IGL02951:Rims2 APN 15 39534938 missense probably damaging 1.00
IGL03009:Rims2 APN 15 39566997 missense possibly damaging 0.85
IGL03080:Rims2 APN 15 39535903 missense probably damaging 1.00
IGL03102:Rims2 APN 15 39459593 missense possibly damaging 0.95
IGL03252:Rims2 APN 15 39452352 missense probably benign
IGL03365:Rims2 APN 15 39476541 missense probably damaging 1.00
IGL03393:Rims2 APN 15 39462613 splice site probably null
IGL03409:Rims2 APN 15 39456733 missense probably damaging 1.00
PIT4486001:Rims2 UTSW 15 39476520 missense possibly damaging 0.67
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0078:Rims2 UTSW 15 39534855 missense probably benign 0.42
R0367:Rims2 UTSW 15 39462615 splice site probably null
R0401:Rims2 UTSW 15 39509632 splice site probably benign
R0531:Rims2 UTSW 15 39567030 missense probably damaging 1.00
R0791:Rims2 UTSW 15 39679625 splice site probably benign
R0838:Rims2 UTSW 15 39681025 missense probably benign 0.02
R1201:Rims2 UTSW 15 39616324 missense possibly damaging 0.91
R1318:Rims2 UTSW 15 39517826 missense probably damaging 0.99
R1457:Rims2 UTSW 15 39511314 missense possibly damaging 0.63
R1619:Rims2 UTSW 15 39506986 missense probably damaging 1.00
R1672:Rims2 UTSW 15 39292189 missense probably benign 0.09
R1743:Rims2 UTSW 15 39679650 missense probably benign 0.10
R1766:Rims2 UTSW 15 39462580 missense probably damaging 0.99
R1779:Rims2 UTSW 15 39681702 missense probably damaging 1.00
R1804:Rims2 UTSW 15 39437043 nonsense probably null
R1985:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R1986:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R2113:Rims2 UTSW 15 39511326 missense probably benign 0.17
R2510:Rims2 UTSW 15 39585652 missense probably damaging 1.00
R3693:Rims2 UTSW 15 39478575 missense probably benign 0.01
R3937:Rims2 UTSW 15 39437845 missense probably damaging 1.00
R4425:Rims2 UTSW 15 39437924 critical splice donor site probably null
R4453:Rims2 UTSW 15 39292208 missense probably damaging 1.00
R4474:Rims2 UTSW 15 39462560 missense probably damaging 1.00
R4518:Rims2 UTSW 15 39437526 missense probably damaging 1.00
R4526:Rims2 UTSW 15 39437717 missense probably damaging 1.00
R4833:Rims2 UTSW 15 39535914 missense probably damaging 0.98
R4936:Rims2 UTSW 15 39437728 missense probably damaging 1.00
R4993:Rims2 UTSW 15 39454445 missense possibly damaging 0.90
R5001:Rims2 UTSW 15 39452428 missense probably benign 0.03
R5054:Rims2 UTSW 15 39517869 intron probably null
R5072:Rims2 UTSW 15 39462590 missense probably benign 0.01
R5171:Rims2 UTSW 15 39437103 missense probably damaging 1.00
R5429:Rims2 UTSW 15 39345355 missense probably damaging 1.00
R5623:Rims2 UTSW 15 39478615 missense probably damaging 1.00
R5624:Rims2 UTSW 15 39345413 missense possibly damaging 0.46
R5685:Rims2 UTSW 15 39437206 missense possibly damaging 0.67
R5784:Rims2 UTSW 15 39535987 splice site probably null
R5790:Rims2 UTSW 15 39681045 missense probably damaging 1.00
R5822:Rims2 UTSW 15 39476490 missense probably damaging 1.00
R5963:Rims2 UTSW 15 39437182 missense probably damaging 1.00
R5988:Rims2 UTSW 15 39292182 missense probably damaging 1.00
R6057:Rims2 UTSW 15 39675020 missense probably damaging 1.00
R6239:Rims2 UTSW 15 39198363 start codon destroyed unknown
R6407:Rims2 UTSW 15 39452328 missense probably damaging 1.00
R6418:Rims2 UTSW 15 39509696 missense probably damaging 1.00
R6495:Rims2 UTSW 15 39517812 missense probably benign 0.01
R6502:Rims2 UTSW 15 39534855 missense probably benign 0.42
R6753:Rims2 UTSW 15 39566973 missense possibly damaging 0.74
R6855:Rims2 UTSW 15 39345515 missense probably benign 0.06
R6948:Rims2 UTSW 15 39511341 missense probably benign
R7058:Rims2 UTSW 15 39585648 missense probably damaging 1.00
R7167:Rims2 UTSW 15 39437077 missense probably benign
R7217:Rims2 UTSW 15 39476489 missense probably damaging 0.99
R7223:Rims2 UTSW 15 39437032 missense probably benign 0.30
R7289:Rims2 UTSW 15 39437718 missense probably benign 0.00
R7459:Rims2 UTSW 15 39517839 missense probably benign
R7663:Rims2 UTSW 15 39507026 missense probably damaging 1.00
X0034:Rims2 UTSW 15 39437534 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTCTTAGTTGGATGGTCAAAGTC -3'
(R):5'- CATGCCCAAGCTTTAGTATATTAGC -3'

Sequencing Primer
(F):5'- GTTGTAACTAGATTGCTGTGA -3'
(R):5'- GTTTTCACTGTCAGATGTACAATCAC -3'
Posted On2014-10-16