Mutagenetix > Incidental Mutations

Incidental Mutation 'R2260:Triobp'

243754

Institutional Source

Beutler Lab

Gene Symbol

Triobp

Ensembl Gene

ENSMUSG00000033088

Gene Name

TRIO and F-actin binding protein

Synonyms

EST478828, Mus EST 478828, Tara

MMRRC Submission

040260-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2260 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78947724-79005869 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to G at 78991440 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]

Predicted Effect

probably null
Transcript: ENSMUST00000109687

SMART Domains

Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
PH	7	104	6.2e-19	SMART
coiled coil region	277	304	N/A	INTRINSIC
coiled coil region	339	377	N/A	INTRINSIC
coiled coil region	401	463	N/A	INTRINSIC
coiled coil region	497	576	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000109688

SMART Domains

Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
low complexity region	30	47	N/A	INTRINSIC
PH	54	151	6.2e-19	SMART
coiled coil region	324	351	N/A	INTRINSIC
coiled coil region	386	424	N/A	INTRINSIC
coiled coil region	448	510	N/A	INTRINSIC
coiled coil region	544	623	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000109689

SMART Domains

Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	7.43e-13	PROSPERO
internal_repeat_1	390	540	7.43e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1395	1492	6.2e-19	SMART
coiled coil region	1665	1692	N/A	INTRINSIC
coiled coil region	1727	1765	N/A	INTRINSIC
coiled coil region	1789	1851	N/A	INTRINSIC
coiled coil region	1885	1964	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000109690

SMART Domains

Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	9.24e-13	PROSPERO
internal_repeat_1	390	540	9.24e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1441	1538	6.2e-19	SMART
coiled coil region	1711	1738	N/A	INTRINSIC
coiled coil region	1773	1811	N/A	INTRINSIC
coiled coil region	1835	1897	N/A	INTRINSIC
coiled coil region	1931	2010	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000130663

SMART Domains

Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
PH	7	104	6.2e-19	SMART
coiled coil region	277	304	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000144151

SMART Domains

Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
PH	1	92	1.04e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000229270

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230425

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,216,917	N1252I	probably damaging	Het
Acot5	A	T	12: 84,075,869	H409L	possibly damaging	Het
Adgrv1	A	T	13: 81,568,374	V840E	probably damaging	Het
Adnp2	A	T	18: 80,128,449	M915K	probably benign	Het
Cd101	G	C	3: 101,016,945	L393V	possibly damaging	Het
Cd177	A	G	7: 24,756,236	V287A	possibly damaging	Het
Cdc37l1	A	T	19: 29,007,048	K194N	probably benign	Het
Cep126	T	C	9: 8,101,748	T262A	possibly damaging	Het
Chit1	A	G	1: 134,151,127	S392G	probably benign	Het
Col11a2	A	G	17: 34,039,677	H8R	probably benign	Het
Dusp12	C	T	1: 170,881,011	R120H	probably damaging	Het
Eln	C	A	5: 134,729,654	A126S	unknown	Het
Entpd2	C	T	2: 25,398,087	P108S	probably damaging	Het
Fkbp6	C	T	5: 135,337,614		probably null	Het
Ftcd	T	A	10: 76,588,059		probably null	Het
Gdf10	T	C	14: 33,932,277	L247P	probably damaging	Het
Gigyf1	C	A	5: 137,520,332	A215E	possibly damaging	Het
Gja4	C	A	4: 127,312,830	D47Y	probably damaging	Het
Gsn	G	A	2: 35,290,337	G130E	probably damaging	Het
Hrasls5	C	T	19: 7,612,746	R46C	probably damaging	Het
Hrc	C	A	7: 45,336,681	R419S	possibly damaging	Het
Itfg1	C	T	8: 85,722,677	C576Y	probably damaging	Het
Lama1	G	T	17: 67,737,507	A134S	probably damaging	Het
Larp4	T	G	15: 99,997,396	F283L	possibly damaging	Het
Marveld2	A	G	13: 100,612,470	S34P	probably benign	Het
Mettl18	T	A	1: 163,996,825	D238E	probably benign	Het
Mfn1	G	T	3: 32,563,426	E74*	probably null	Het
Mfn2	C	A	4: 147,894,606	E90*	probably null	Het
Mill2	T	A	7: 18,856,488	D164E	probably benign	Het
Ncapd3	A	G	9: 27,056,072	D568G	probably benign	Het
Nt5c1b	A	T	12: 10,374,965	R170S	probably damaging	Het
Olfr1186	G	A	2: 88,526,386	V268I	possibly damaging	Het
Olfr1333	T	C	4: 118,830,162	I93V	probably damaging	Het
Olfr1350	A	T	7: 6,570,023	I11F	probably damaging	Het
Olfr933	T	C	9: 38,976,000	V108A	probably benign	Het
Pald1	G	A	10: 61,352,971	R87W	probably damaging	Het
Paox	T	A	7: 140,134,054	Y242*	probably null	Het
Pde2a	A	T	7: 101,484,567	D85V	probably damaging	Het
Pitrm1	C	T	13: 6,560,125	T411I	probably damaging	Het
Pkd1l3	A	G	8: 109,623,636	Q371R	probably benign	Het
Ptprk	A	G	10: 28,206,149	D38G	possibly damaging	Het
Rag2	G	A	2: 101,630,238	E298K	probably benign	Het
Rbm12b2	G	A	4: 12,095,061	R640H	probably benign	Het
Rcsd1	C	T	1: 165,659,429	A72T	probably benign	Het
Rims2	G	T	15: 39,478,566	E604*	probably null	Het
Rin2	A	G	2: 145,878,904	D719G	probably damaging	Het
Sash1	G	A	10: 8,786,378	Q155*	probably null	Het
Tacr1	A	T	6: 82,403,775	I56F	probably damaging	Het
Tbc1d4	G	A	14: 101,494,411	T455M	probably damaging	Het
Tex24	C	T	8: 27,344,855	T137I	probably damaging	Het
Tmem200a	A	C	10: 25,993,415	S319A	probably benign	Het
Tmem242	G	T	17: 5,433,470	A99E	probably damaging	Het
Tmem30a	C	T	9: 79,774,164	R277H	probably benign	Het
Tmprss11f	G	A	5: 86,591,410	A4V	probably benign	Het
Tshz2	A	T	2: 169,886,406	Q505L	probably benign	Het
Ttyh1	T	C	7: 4,128,184	V218A	probably damaging	Het
Vmn2r11	A	T	5: 109,053,791	Y282*	probably null	Het
Vps13c	A	G	9: 67,953,860	N2891S	probably benign	Het
Xpo5	C	T	17: 46,240,896	Q1050*	probably null	Het

Other mutations in Triobp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Triobp	APN	15	78993368	missense	probably damaging	1.00
IGL01904:Triobp	APN	15	78967364	missense	possibly damaging	0.80
IGL01957:Triobp	APN	15	78972647	critical splice donor site	probably null
IGL02085:Triobp	APN	15	78974297	splice site	probably benign
IGL02260:Triobp	APN	15	78966362	missense	probably benign	0.00
IGL02498:Triobp	APN	15	78961043	missense	probably benign	0.01
IGL02551:Triobp	APN	15	78973489	missense	probably benign
IGL02740:Triobp	APN	15	78966689	missense	probably benign	0.21
IGL02810:Triobp	APN	15	79002203	missense	possibly damaging	0.95
IGL03063:Triobp	APN	15	78990884	missense	probably damaging	1.00
FR4304:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4340:Triobp	UTSW	15	78993390	unclassified	probably benign
FR4342:Triobp	UTSW	15	78993392	unclassified	probably benign
FR4449:Triobp	UTSW	15	78993389	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993390	unclassified	probably benign
R0276:Triobp	UTSW	15	78973676	missense	probably benign	0.09
R0309:Triobp	UTSW	15	78976540	missense	probably damaging	1.00
R0433:Triobp	UTSW	15	78968201	missense	possibly damaging	0.69
R0464:Triobp	UTSW	15	78966986	missense	possibly damaging	0.71
R0525:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0665:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0689:Triobp	UTSW	15	78959988	nonsense	probably null
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1151:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1152:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1510:Triobp	UTSW	15	79003767	missense	probably damaging	1.00
R1519:Triobp	UTSW	15	78973738	missense	probably benign	0.00
R1642:Triobp	UTSW	15	79002148	missense	probably damaging	1.00
R1732:Triobp	UTSW	15	78967228	missense	possibly damaging	0.69
R1755:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1975:Triobp	UTSW	15	78966708	missense	probably benign
R2051:Triobp	UTSW	15	79004540	missense	probably damaging	1.00
R2073:Triobp	UTSW	15	78973895	missense	probably damaging	0.99
R2351:Triobp	UTSW	15	79004580	missense	probably benign	0.09
R2902:Triobp	UTSW	15	78973418	missense	possibly damaging	0.90
R3801:Triobp	UTSW	15	78973700	missense	probably benign	0.04
R3959:Triobp	UTSW	15	79002389	nonsense	probably null
R4003:Triobp	UTSW	15	78959977	unclassified	probably benign
R4084:Triobp	UTSW	15	78973671	missense	probably benign	0.19
R4482:Triobp	UTSW	15	78966563	missense	possibly damaging	0.87
R4592:Triobp	UTSW	15	78967095	missense	probably benign
R4662:Triobp	UTSW	15	78993269	missense	probably damaging	1.00
R4732:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4733:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4789:Triobp	UTSW	15	78991028	missense	probably damaging	1.00
R4968:Triobp	UTSW	15	78966616	missense	probably benign	0.03
R4990:Triobp	UTSW	15	78967005	missense	probably benign	0.00
R5129:Triobp	UTSW	15	78961096	missense	probably benign	0.15
R5181:Triobp	UTSW	15	78967754	missense	probably benign	0.00
R5279:Triobp	UTSW	15	78994391	missense	possibly damaging	0.66
R5584:Triobp	UTSW	15	78968132	missense	possibly damaging	0.89
R5601:Triobp	UTSW	15	78973633	missense	probably damaging	1.00
R5810:Triobp	UTSW	15	78968267	missense	probably benign	0.07
R5969:Triobp	UTSW	15	78967540	missense	probably benign	0.05
R6722:Triobp	UTSW	15	79001565	missense	probably damaging	1.00
R6739:Triobp	UTSW	15	78966366	missense	possibly damaging	0.77
R6810:Triobp	UTSW	15	78966615	missense	possibly damaging	0.47
R7011:Triobp	UTSW	15	78978723	missense	probably damaging	0.98
R7015:Triobp	UTSW	15	78994060	missense	probably damaging	0.99
R7200:Triobp	UTSW	15	78966842	small deletion	probably benign
R7294:Triobp	UTSW	15	78973976	missense	probably damaging	0.99
X0026:Triobp	UTSW	15	78960023	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ACCTAGAGAGTCCTGGAGTG -3'
(R):5'- TCATCTCTGGATGGCCAAGGAC -3'

Sequencing Primer
(F):5'- TGGAGTGAGGCACTTTCCAC -3'
(R):5'- AAGGACACGTGCTGCTCTTTC -3'

Posted On

2014-10-16