Incidental Mutation 'R2261:Slc19a3'
ID243770
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
MMRRC Submission 040261-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R2261 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83022957 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 113 (F113Y)
Ref Sequence ENSEMBL: ENSMUSP00000126646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect probably damaging
Transcript: ENSMUST00000045560
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142805
Predicted Effect probably damaging
Transcript: ENSMUST00000164473
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Meta Mutation Damage Score 0.4327 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,288 M1384L probably benign Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Arhgap31 T A 16: 38,609,277 Q412L probably damaging Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Cacna1g T A 11: 94,457,135 H709L probably benign Het
Cacna1h T C 17: 25,433,165 T2A possibly damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap69 C A 5: 5,596,018 V561F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fam184a A G 10: 53,647,570 probably null Het
Fanca A G 8: 123,289,359 probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Gbp2b G A 3: 142,606,735 S293N probably benign Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Gm12874 G A 4: 122,593,740 noncoding transcript Het
Golgb1 T A 16: 36,893,360 F234L probably damaging Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Grip1 G A 10: 119,985,584 V385M probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mast4 A G 13: 102,798,207 probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Morc3 T A 16: 93,853,221 probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Npy2r A G 3: 82,541,039 V30A possibly damaging Het
Nsd2 A T 5: 33,885,527 Q1045L probably damaging Het
Olfr1168 T A 2: 88,185,621 I248N probably damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Otub1 T A 19: 7,199,496 probably null Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhm2 C T 4: 141,642,732 E29K probably damaging Het
Ralgapa2 T C 2: 146,342,683 N1468S probably damaging Het
Rnf111 T C 9: 70,476,391 S87G probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Slc20a1 A G 2: 129,206,474 R260G possibly damaging Het
Slk T C 19: 47,637,352 I1090T probably damaging Het
Spr-ps1 G T 6: 85,155,963 noncoding transcript Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
St18 T A 1: 6,845,572 C814S probably damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Taar3 A G 10: 23,950,155 I200V probably benign Het
Tmem184c A G 8: 77,597,043 Y397H probably damaging Het
Tmem184c T C 8: 77,597,175 T353A probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Ubr4 T C 4: 139,413,462 S1231P probably damaging Het
Ubr5 A T 15: 37,988,284 D2143E probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Zmym2 G A 14: 56,928,262 E681K probably damaging Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
tag UTSW 1 83026260 missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83022762 missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2404:Slc19a3 UTSW 1 83023035 missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83022561 missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83026360 missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 83013928 missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83026260 missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83022748 missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 83019441 missense probably benign 0.02
R8150:Slc19a3 UTSW 1 83022495 missense probably damaging 1.00
R8412:Slc19a3 UTSW 1 83014812 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAGTATGGCAGGTTCGTCAG -3'
(R):5'- TGTGTTGTGCTTCTGACCATAC -3'

Sequencing Primer
(F):5'- GCAGGTTCGTCAGGGATAC -3'
(R):5'- GACAAATGAGATCCTTCCTGTTTGG -3'
Posted On2014-10-16