Incidental Mutation 'R2261:Vmn2r6'
ID 243777
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Name vomeronasal 2, receptor 6
Synonyms EG667069, EG620718
MMRRC Submission 040261-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.241) question?
Stock # R2261 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 64444916-64472855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64464090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 248 (N248S)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
AlphaFold H3BK29
Predicted Effect probably benign
Transcript: ENSMUST00000165012
AA Change: N159S

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: N159S

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176481
AA Change: N248S

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: N248S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,288 (GRCm39) M1384L probably benign Het
Ahdc1 A G 4: 132,790,474 (GRCm39) T572A unknown Het
Arhgap31 T A 16: 38,429,639 (GRCm39) Q412L probably damaging Het
Arsi T C 18: 61,049,737 (GRCm39) Y207H probably damaging Het
Bco1 T C 8: 117,859,764 (GRCm39) L489S probably damaging Het
Cacna1g T A 11: 94,347,961 (GRCm39) H709L probably benign Het
Cacna1h T C 17: 25,652,139 (GRCm39) T2A possibly damaging Het
Casz1 G T 4: 149,013,556 (GRCm39) R40L probably damaging Het
Cdh23 A G 10: 60,152,907 (GRCm39) V2372A probably damaging Het
Cdk17 T A 10: 93,047,820 (GRCm39) S56T possibly damaging Het
Ces2h T A 8: 105,743,191 (GRCm39) M142K probably damaging Het
Cfap69 C A 5: 5,646,018 (GRCm39) V561F probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Dnah11 T A 12: 117,843,760 (GRCm39) M4362L probably benign Het
Dnah11 T C 12: 117,930,374 (GRCm39) T3324A probably damaging Het
Dnajc3 A G 14: 119,198,232 (GRCm39) Q118R probably damaging Het
Dok4 A T 8: 95,593,140 (GRCm39) C182S probably damaging Het
Fam184a A G 10: 53,523,666 (GRCm39) probably null Het
Fanca A G 8: 124,016,098 (GRCm39) probably null Het
Flt3 G A 5: 147,284,873 (GRCm39) P748L probably benign Het
Gbp2b G A 3: 142,312,496 (GRCm39) S293N probably benign Het
Gbp8 T C 5: 105,163,999 (GRCm39) Q433R possibly damaging Het
Gm12874 G A 4: 122,487,533 (GRCm39) noncoding transcript Het
Golgb1 T A 16: 36,713,722 (GRCm39) F234L probably damaging Het
Gpr65 A T 12: 98,241,494 (GRCm39) N49I probably damaging Het
Grip1 G A 10: 119,821,489 (GRCm39) V385M probably benign Het
Ltbp3 G A 19: 5,804,050 (GRCm39) R854Q probably benign Het
Mast4 A G 13: 102,934,715 (GRCm39) probably benign Het
Mia3 A G 1: 183,115,647 (GRCm39) Y295H probably benign Het
Morc3 T A 16: 93,650,109 (GRCm39) probably benign Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Nell1 C T 7: 50,210,569 (GRCm39) T494I possibly damaging Het
Npy2r A G 3: 82,448,346 (GRCm39) V30A possibly damaging Het
Nsd2 A T 5: 34,042,871 (GRCm39) Q1045L probably damaging Het
Or51t4 T C 7: 102,598,464 (GRCm39) F254S probably damaging Het
Or5d40 T A 2: 88,015,965 (GRCm39) I248N probably damaging Het
Otub1 T A 19: 7,176,861 (GRCm39) probably null Het
Pcdh1 A T 18: 38,331,710 (GRCm39) L431H probably benign Het
Pdgfra T C 5: 75,346,184 (GRCm39) V778A probably benign Het
Plekhm2 C T 4: 141,370,043 (GRCm39) E29K probably damaging Het
Ralgapa2 T C 2: 146,184,603 (GRCm39) N1468S probably damaging Het
Rnf111 T C 9: 70,383,673 (GRCm39) S87G probably benign Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Saxo1 C T 4: 86,397,212 (GRCm39) D109N probably damaging Het
Slc19a3 A T 1: 83,000,678 (GRCm39) F113Y probably damaging Het
Slc20a1 A G 2: 129,048,394 (GRCm39) R260G possibly damaging Het
Slk T C 19: 47,625,791 (GRCm39) I1090T probably damaging Het
Spr-ps1 G T 6: 85,132,945 (GRCm39) noncoding transcript Het
Ssh1 T C 5: 114,080,764 (GRCm39) S867G possibly damaging Het
St18 T A 1: 6,915,796 (GRCm39) C814S probably damaging Het
Stmn2 T C 3: 8,606,955 (GRCm39) F25S probably damaging Het
Taar3 A G 10: 23,826,053 (GRCm39) I200V probably benign Het
Tmem184c A G 8: 78,323,672 (GRCm39) Y397H probably damaging Het
Tmem184c T C 8: 78,323,804 (GRCm39) T353A probably damaging Het
Tuba1c A G 15: 98,935,757 (GRCm39) H406R probably damaging Het
Ubr4 T C 4: 139,140,773 (GRCm39) S1231P probably damaging Het
Ubr5 A T 15: 37,988,528 (GRCm39) D2143E probably damaging Het
Vmn2r63 G T 7: 42,578,031 (GRCm39) T169N probably benign Het
Zfp37 A T 4: 62,109,873 (GRCm39) L397Q probably damaging Het
Zmym2 G A 14: 57,165,719 (GRCm39) E681K probably damaging Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64,445,525 (GRCm39) missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64,463,766 (GRCm39) missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64,445,323 (GRCm39) missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64,463,610 (GRCm39) missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64,463,749 (GRCm39) missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64,463,911 (GRCm39) missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64,463,917 (GRCm39) missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64,472,574 (GRCm39) missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64,445,428 (GRCm39) missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64,466,966 (GRCm39) nonsense probably null
R0206:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0206:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0208:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0427:Vmn2r6 UTSW 3 64,467,008 (GRCm39) missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64,463,723 (GRCm39) missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64,464,261 (GRCm39) missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64,445,487 (GRCm39) missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64,472,488 (GRCm39) missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64,464,211 (GRCm39) missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64,445,694 (GRCm39) missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64,445,579 (GRCm39) nonsense probably null
R1498:Vmn2r6 UTSW 3 64,463,890 (GRCm39) missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64,463,698 (GRCm39) missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64,445,262 (GRCm39) missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64,463,519 (GRCm39) missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64,467,139 (GRCm39) missense probably damaging 1.00
R2262:Vmn2r6 UTSW 3 64,464,090 (GRCm39) missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64,463,773 (GRCm39) missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64,445,707 (GRCm39) missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64,464,211 (GRCm39) missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64,454,760 (GRCm39) missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64,454,760 (GRCm39) missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64,463,929 (GRCm39) missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64,464,042 (GRCm39) missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64,463,893 (GRCm39) missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64,445,671 (GRCm39) missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64,445,671 (GRCm39) missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64,445,369 (GRCm39) missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64,445,145 (GRCm39) missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64,467,068 (GRCm39) missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64,454,829 (GRCm39) missense probably benign
R4934:Vmn2r6 UTSW 3 64,463,766 (GRCm39) missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64,445,207 (GRCm39) missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64,445,044 (GRCm39) missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64,464,015 (GRCm39) missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64,445,935 (GRCm39) missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64,445,411 (GRCm39) missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64,464,263 (GRCm39) missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64,463,454 (GRCm39) missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64,472,652 (GRCm39) missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64,463,953 (GRCm39) missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64,467,176 (GRCm39) missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64,445,424 (GRCm39) missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64,464,226 (GRCm39) missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64,454,801 (GRCm39) nonsense probably null
R6645:Vmn2r6 UTSW 3 64,464,297 (GRCm39) missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64,445,580 (GRCm39) missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64,464,195 (GRCm39) missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64,447,372 (GRCm39) nonsense probably null
R7562:Vmn2r6 UTSW 3 64,463,941 (GRCm39) missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64,472,683 (GRCm39) missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64,472,563 (GRCm39) missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64,463,991 (GRCm39) missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64,445,443 (GRCm39) missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64,467,241 (GRCm39) missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64,467,245 (GRCm39) missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64,455,064 (GRCm39) intron probably benign
R8169:Vmn2r6 UTSW 3 64,447,310 (GRCm39) missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64,463,526 (GRCm39) nonsense probably null
R8736:Vmn2r6 UTSW 3 64,467,221 (GRCm39) missense probably damaging 1.00
R8962:Vmn2r6 UTSW 3 64,463,576 (GRCm39) missense probably damaging 1.00
R9139:Vmn2r6 UTSW 3 64,464,277 (GRCm39) missense probably benign 0.12
R9206:Vmn2r6 UTSW 3 64,467,032 (GRCm39) missense probably damaging 0.97
R9295:Vmn2r6 UTSW 3 64,463,484 (GRCm39) missense probably benign 0.00
R9332:Vmn2r6 UTSW 3 64,454,671 (GRCm39) missense probably benign 0.01
R9616:Vmn2r6 UTSW 3 64,445,724 (GRCm39) missense probably damaging 1.00
R9663:Vmn2r6 UTSW 3 64,463,549 (GRCm39) missense possibly damaging 0.90
R9685:Vmn2r6 UTSW 3 64,464,081 (GRCm39) missense probably benign 0.19
X0020:Vmn2r6 UTSW 3 64,445,871 (GRCm39) missense probably benign
X0066:Vmn2r6 UTSW 3 64,454,799 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64,463,746 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCGGTGGCTATCCATGTCC -3'
(R):5'- CAGGTGGGATATGCTTCTTCCTC -3'

Sequencing Primer
(F):5'- GTGGCTATCCATGTCCTGTCAG -3'
(R):5'- ATGCTTCTTCCTCCTCAATTTTTAG -3'
Posted On 2014-10-16