Incidental Mutation 'R2261:Plekhm2'
ID243786
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
MMRRC Submission 040261-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2261 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141642732 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 29 (E29K)
Ref Sequence ENSEMBL: ENSMUSP00000030751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
Predicted Effect probably damaging
Transcript: ENSMUST00000030751
AA Change: E29K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: E29K

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000084203
AA Change: E29K

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: E29K

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141844
Meta Mutation Damage Score 0.2429 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,288 M1384L probably benign Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Arhgap31 T A 16: 38,609,277 Q412L probably damaging Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Cacna1g T A 11: 94,457,135 H709L probably benign Het
Cacna1h T C 17: 25,433,165 T2A possibly damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap69 C A 5: 5,596,018 V561F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fam184a A G 10: 53,647,570 probably null Het
Fanca A G 8: 123,289,359 probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Gbp2b G A 3: 142,606,735 S293N probably benign Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Gm12874 G A 4: 122,593,740 noncoding transcript Het
Golgb1 T A 16: 36,893,360 F234L probably damaging Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Grip1 G A 10: 119,985,584 V385M probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mast4 A G 13: 102,798,207 probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Morc3 T A 16: 93,853,221 probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Npy2r A G 3: 82,541,039 V30A possibly damaging Het
Nsd2 A T 5: 33,885,527 Q1045L probably damaging Het
Olfr1168 T A 2: 88,185,621 I248N probably damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Otub1 T A 19: 7,199,496 probably null Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Ralgapa2 T C 2: 146,342,683 N1468S probably damaging Het
Rnf111 T C 9: 70,476,391 S87G probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc20a1 A G 2: 129,206,474 R260G possibly damaging Het
Slk T C 19: 47,637,352 I1090T probably damaging Het
Spr-ps1 G T 6: 85,155,963 noncoding transcript Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
St18 T A 1: 6,845,572 C814S probably damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Taar3 A G 10: 23,950,155 I200V probably benign Het
Tmem184c A G 8: 77,597,043 Y397H probably damaging Het
Tmem184c T C 8: 77,597,175 T353A probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Ubr4 T C 4: 139,413,462 S1231P probably damaging Het
Ubr5 A T 15: 37,988,284 D2143E probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Zmym2 G A 14: 56,928,262 E681K probably damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141632121 missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141627825 missense probably benign 0.04
R8504:Plekhm2 UTSW 4 141642453 missense probably damaging 1.00
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense possibly damaging 0.77
Z1177:Plekhm2 UTSW 4 141639822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTGCAACCTGTGAGGATGG -3'
(R):5'- ACTGTGTATGATGCCCAGGC -3'

Sequencing Primer
(F):5'- AGCAGTGCTGGGCTGAG -3'
(R):5'- TATGATGCCCAGGCTGCAAG -3'
Posted On2014-10-16