Incidental Mutation 'R2261:Cdk17'
ID243810
Institutional Source Beutler Lab
Gene Symbol Cdk17
Ensembl Gene ENSMUSG00000020015
Gene Namecyclin-dependent kinase 17
SynonymsPctk2, 6430598J10Rik
MMRRC Submission 040261-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R2261 (G1)
Quality Score209
Status Validated
Chromosome10
Chromosomal Location93160875-93267071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93211958 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 56 (S56T)
Ref Sequence ENSEMBL: ENSMUSP00000149297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069965] [ENSMUST00000213378] [ENSMUST00000214445] [ENSMUST00000215286]
Predicted Effect probably benign
Transcript: ENSMUST00000069965
AA Change: S56T

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070355
Gene: ENSMUSG00000020015
AA Change: S56T

DomainStartEndE-ValueType
S_TKc 192 473 4.67e-97 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213378
AA Change: S56T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000214445
Predicted Effect possibly damaging
Transcript: ENSMUST00000215286
AA Change: S23T

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215495
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cdc2/cdkx subfamily of the ser/thr family of protein kinases. It has similarity to a rat protein that is thought to play a role in terminally differentiated neurons. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,288 M1384L probably benign Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Arhgap31 T A 16: 38,609,277 Q412L probably damaging Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Cacna1g T A 11: 94,457,135 H709L probably benign Het
Cacna1h T C 17: 25,433,165 T2A possibly damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap69 C A 5: 5,596,018 V561F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fam184a A G 10: 53,647,570 probably null Het
Fanca A G 8: 123,289,359 probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Gbp2b G A 3: 142,606,735 S293N probably benign Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Gm12874 G A 4: 122,593,740 noncoding transcript Het
Golgb1 T A 16: 36,893,360 F234L probably damaging Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Grip1 G A 10: 119,985,584 V385M probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mast4 A G 13: 102,798,207 probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Morc3 T A 16: 93,853,221 probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Npy2r A G 3: 82,541,039 V30A possibly damaging Het
Nsd2 A T 5: 33,885,527 Q1045L probably damaging Het
Olfr1168 T A 2: 88,185,621 I248N probably damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Otub1 T A 19: 7,199,496 probably null Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhm2 C T 4: 141,642,732 E29K probably damaging Het
Ralgapa2 T C 2: 146,342,683 N1468S probably damaging Het
Rnf111 T C 9: 70,476,391 S87G probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc20a1 A G 2: 129,206,474 R260G possibly damaging Het
Slk T C 19: 47,637,352 I1090T probably damaging Het
Spr-ps1 G T 6: 85,155,963 noncoding transcript Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
St18 T A 1: 6,845,572 C814S probably damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Taar3 A G 10: 23,950,155 I200V probably benign Het
Tmem184c A G 8: 77,597,043 Y397H probably damaging Het
Tmem184c T C 8: 77,597,175 T353A probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Ubr4 T C 4: 139,413,462 S1231P probably damaging Het
Ubr5 A T 15: 37,988,284 D2143E probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Zmym2 G A 14: 56,928,262 E681K probably damaging Het
Other mutations in Cdk17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cdk17 APN 10 93226771 missense probably damaging 1.00
IGL00781:Cdk17 APN 10 93232416 missense probably damaging 1.00
IGL01622:Cdk17 APN 10 93238962 unclassified probably benign
IGL01623:Cdk17 APN 10 93238962 unclassified probably benign
IGL01732:Cdk17 APN 10 93218045 missense probably benign 0.01
IGL01768:Cdk17 APN 10 93208261 missense probably damaging 0.99
IGL02942:Cdk17 APN 10 93238968 missense probably benign
IGL03308:Cdk17 APN 10 93221644 critical splice donor site probably null
R0039:Cdk17 UTSW 10 93226778 splice site probably benign
R0398:Cdk17 UTSW 10 93237840 missense probably benign 0.01
R0432:Cdk17 UTSW 10 93237790 unclassified probably benign
R0609:Cdk17 UTSW 10 93216472 missense probably benign
R0781:Cdk17 UTSW 10 93239033 nonsense probably null
R1110:Cdk17 UTSW 10 93239033 nonsense probably null
R1604:Cdk17 UTSW 10 93232498 missense probably damaging 1.00
R1674:Cdk17 UTSW 10 93221630 missense probably benign 0.21
R1758:Cdk17 UTSW 10 93208250 missense probably damaging 1.00
R1797:Cdk17 UTSW 10 93208252 missense possibly damaging 0.76
R1864:Cdk17 UTSW 10 93226105 missense probably damaging 1.00
R1924:Cdk17 UTSW 10 93226117 missense probably damaging 1.00
R1929:Cdk17 UTSW 10 93228678 missense probably damaging 1.00
R2143:Cdk17 UTSW 10 93218019 missense probably damaging 1.00
R2207:Cdk17 UTSW 10 93228762 missense probably damaging 1.00
R2262:Cdk17 UTSW 10 93211958 missense possibly damaging 0.90
R3737:Cdk17 UTSW 10 93221644 critical splice donor site probably null
R3883:Cdk17 UTSW 10 93212077 critical splice donor site probably null
R4436:Cdk17 UTSW 10 93211896 splice site probably null
R5372:Cdk17 UTSW 10 93226039 missense probably benign 0.03
R5444:Cdk17 UTSW 10 93217961 splice site probably null
R5488:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5489:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5815:Cdk17 UTSW 10 93228697 missense probably damaging 1.00
R6164:Cdk17 UTSW 10 93235469 missense probably benign 0.26
R6209:Cdk17 UTSW 10 93208231 missense probably benign 0.05
R6384:Cdk17 UTSW 10 93211965 missense probably damaging 0.99
R6627:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R6698:Cdk17 UTSW 10 93228678 missense probably damaging 1.00
R7164:Cdk17 UTSW 10 93232481 missense probably benign 0.07
R8096:Cdk17 UTSW 10 93216367 missense probably damaging 0.98
R8118:Cdk17 UTSW 10 93216390 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATCGCCAAAGAAGTGAGCTTAC -3'
(R):5'- ATCTGACAATGACAGAGGCTGG -3'

Sequencing Primer
(F):5'- CATGTAAATGATCTCTGTTACAGCC -3'
(R):5'- TGACACTCAGTGCACATGTCCTAG -3'
Posted On2014-10-16