Incidental Mutation 'R2262:Zfp37'
ID 243846
Institutional Source Beutler Lab
Gene Symbol Zfp37
Ensembl Gene ENSMUSG00000028389
Gene Name zinc finger protein 37
Synonyms Zfp-37, Tzn
MMRRC Submission 040262-MU
Accession Numbers

Genbank: NM_009554.3; Ensembl: ENSMUST00000068822

Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock # R2262 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 62189540-62231047 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62191636 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 397 (L397Q)
Ref Sequence ENSEMBL: ENSMUSP00000152400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068822] [ENSMUST00000129511] [ENSMUST00000220873] [ENSMUST00000221329] [ENSMUST00000222050] [ENSMUST00000222748]
AlphaFold P17141
Predicted Effect probably damaging
Transcript: ENSMUST00000068822
AA Change: L438Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070463
Gene: ENSMUSG00000028389
AA Change: L438Q

DomainStartEndE-ValueType
KRAB 13 62 5.89e-12 SMART
low complexity region 113 122 N/A INTRINSIC
ZnF_C2H2 255 277 2.75e-3 SMART
ZnF_C2H2 283 305 3.95e-4 SMART
ZnF_C2H2 311 333 2.2e-2 SMART
ZnF_C2H2 339 361 8.02e-5 SMART
ZnF_C2H2 367 389 1.13e-4 SMART
ZnF_C2H2 395 417 9.88e-5 SMART
ZnF_C2H2 423 445 2.61e-4 SMART
ZnF_C2H2 451 473 6.08e-5 SMART
ZnF_C2H2 479 501 5.99e-4 SMART
ZnF_C2H2 507 529 5.99e-4 SMART
ZnF_C2H2 535 557 1.03e-2 SMART
ZnF_C2H2 563 585 9.88e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129511
AA Change: L84Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148664
Predicted Effect probably damaging
Transcript: ENSMUST00000220873
AA Change: L397Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221329
AA Change: L435Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222050
AA Change: L434Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222748
AA Change: L397Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to a large family of zinc finger proteins. A similar protein in mouse is thought to play a role in regulating the structures of the nucleolus and centromere in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Brinp1 A G 4: 68,829,354 Y171H probably damaging Het
C1rl A T 6: 124,506,948 I186F probably damaging Het
Cacna1d A G 14: 30,491,016 V29A possibly damaging Het
Calcrl T C 2: 84,345,173 D279G probably damaging Het
Cass4 T C 2: 172,427,254 S421P probably damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap161 C T 7: 83,793,372 V78I probably benign Het
Chst8 T A 7: 34,676,010 M135L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcc C T 18: 71,374,551 E917K probably damaging Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fnbp4 G T 2: 90,757,404 L375F probably damaging Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Glt1d1 A G 5: 127,657,112 M117V probably benign Het
Hcar1 A C 5: 123,878,586 D347E probably benign Het
Kif16b T C 2: 142,740,917 K563E probably damaging Het
Klra17 A G 6: 129,874,794 probably null Het
Krt35 C T 11: 100,095,767 M140I probably benign Het
Lamb2 A T 9: 108,480,610 I111F probably damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Noa1 G A 5: 77,309,804 Q85* probably null Het
Nsun4 A T 4: 116,052,950 S138T probably benign Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pde1a T A 2: 80,128,931 probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhj1 A T 10: 80,796,472 N55K probably benign Het
Ptpn20 A G 14: 33,612,311 M49V probably benign Het
Rbm6 A G 9: 107,791,090 L547P probably damaging Het
Rexo1 C T 10: 80,549,569 E552K probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Setd2 A G 9: 110,561,243 probably benign Het
Slc22a28 T C 19: 8,071,208 Y358C probably benign Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Tcirg1 C T 19: 3,903,591 R112H possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Trpc1 T A 9: 95,706,933 N746I probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Vmn1r68 T C 7: 10,527,445 E242G probably damaging Het
Vmn2r29 T A 7: 7,240,086 H22L possibly damaging Het
Vmn2r32 T A 7: 7,474,619 I258L probably benign Het
Vmn2r37 T A 7: 9,217,944 T307S probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vmn2r67 T C 7: 85,136,974 T608A probably damaging Het
Xpo1 T A 11: 23,284,634 probably null Het
Zfp180 T G 7: 24,104,624 V156G probably benign Het
Other mutations in Zfp37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Zfp37 APN 4 62192311 missense possibly damaging 0.69
B6584:Zfp37 UTSW 4 62191378 missense probably damaging 1.00
R0383:Zfp37 UTSW 4 62191885 start codon destroyed probably null 0.61
R0457:Zfp37 UTSW 4 62191665 nonsense probably null
R1258:Zfp37 UTSW 4 62191817 missense probably damaging 1.00
R2072:Zfp37 UTSW 4 62191708 missense probably damaging 1.00
R2073:Zfp37 UTSW 4 62191708 missense probably damaging 1.00
R2261:Zfp37 UTSW 4 62191636 missense probably damaging 1.00
R2507:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R2897:Zfp37 UTSW 4 62191777 missense probably damaging 1.00
R2898:Zfp37 UTSW 4 62191777 missense probably damaging 1.00
R3826:Zfp37 UTSW 4 62192563 missense probably benign 0.00
R3879:Zfp37 UTSW 4 62191335 nonsense probably null
R4034:Zfp37 UTSW 4 62191696 missense probably damaging 1.00
R4491:Zfp37 UTSW 4 62192128 missense probably benign 0.07
R4823:Zfp37 UTSW 4 62191503 missense probably benign 0.18
R5186:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R5650:Zfp37 UTSW 4 62191765 missense probably damaging 1.00
R5886:Zfp37 UTSW 4 62191234 missense probably damaging 1.00
R5925:Zfp37 UTSW 4 62191213 missense possibly damaging 0.47
R7050:Zfp37 UTSW 4 62191671 missense possibly damaging 0.72
R7553:Zfp37 UTSW 4 62191999 missense probably damaging 1.00
R7583:Zfp37 UTSW 4 62192016 start gained probably benign
R7646:Zfp37 UTSW 4 62191295 missense probably damaging 0.99
R8061:Zfp37 UTSW 4 62191428 nonsense probably null
R8076:Zfp37 UTSW 4 62191316 missense possibly damaging 0.67
R8477:Zfp37 UTSW 4 62192003 missense probably damaging 1.00
R8756:Zfp37 UTSW 4 62192134 missense possibly damaging 0.94
R9000:Zfp37 UTSW 4 62208414 missense unknown
R9362:Zfp37 UTSW 4 62192062 missense probably benign 0.11
R9400:Zfp37 UTSW 4 62191667 missense probably damaging 1.00
X0026:Zfp37 UTSW 4 62205089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGCTTTCCCACATTCAACA -3'
(R):5'- TGGCAAAGCACACGGACAT -3'

Sequencing Primer
(F):5'- CATTCAACACACTCATAGGGTTTC -3'
(R):5'- CCTAAGATCTCACACGGGTG -3'
Posted On 2014-10-16