Incidental Mutation 'R2262:Col1a2'
ID243858
Institutional Source Beutler Lab
Gene Symbol Col1a2
Ensembl Gene ENSMUSG00000029661
Gene Namecollagen, type I, alpha 2
SynonymsCola2, Cola-2, Col1a-2
MMRRC Submission 040262-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2262 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4504814-4541544 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 4518822 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031668] [ENSMUST00000141483]
Predicted Effect unknown
Transcript: ENSMUST00000031668
AA Change: R230H
SMART Domains Protein: ENSMUSP00000031668
Gene: ENSMUSG00000029661
AA Change: R230H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 30 91 1e-8 PFAM
Pfam:Collagen 88 155 8.2e-10 PFAM
internal_repeat_3 172 223 7.52e-12 PROSPERO
low complexity region 225 271 N/A INTRINSIC
low complexity region 274 313 N/A INTRINSIC
low complexity region 316 352 N/A INTRINSIC
internal_repeat_2 354 386 2.06e-15 PROSPERO
internal_repeat_1 355 469 5.71e-17 PROSPERO
internal_repeat_4 361 472 2.1e-11 PROSPERO
Pfam:Collagen 475 535 7.7e-11 PFAM
Pfam:Collagen 521 588 8.2e-10 PFAM
low complexity region 598 625 N/A INTRINSIC
low complexity region 628 655 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 724 757 N/A INTRINSIC
low complexity region 759 784 N/A INTRINSIC
low complexity region 792 820 N/A INTRINSIC
internal_repeat_5 823 850 5.93e-7 PROSPERO
low complexity region 853 883 N/A INTRINSIC
Pfam:Collagen 895 969 1e-8 PFAM
low complexity region 987 1007 N/A INTRINSIC
internal_repeat_5 1009 1042 5.93e-7 PROSPERO
Pfam:Collagen 1051 1120 5.8e-9 PFAM
COLFI 1138 1372 2.1e-150 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138511
Predicted Effect probably benign
Transcript: ENSMUST00000141483
SMART Domains Protein: ENSMUSP00000125275
Gene: ENSMUSG00000029661

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 30 89 3.2e-10 PFAM
Pfam:Collagen 87 145 8.5e-10 PFAM
Pfam:Collagen 121 177 3.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148864
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-1 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice harboring certain mutations in the encoded gene exhibit symptoms of moderate to severe forms of osteogenesis imperfecta. [provided by RefSeq, Dec 2015]
PHENOTYPE: The tails of mice heterozygous for an ENU-induced mutation at this locus are flexible or rubbery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Brinp1 A G 4: 68,829,354 Y171H probably damaging Het
C1rl A T 6: 124,506,948 I186F probably damaging Het
Cacna1d A G 14: 30,491,016 V29A possibly damaging Het
Calcrl T C 2: 84,345,173 D279G probably damaging Het
Cass4 T C 2: 172,427,254 S421P probably damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap161 C T 7: 83,793,372 V78I probably benign Het
Chst8 T A 7: 34,676,010 M135L probably benign Het
Dcc C T 18: 71,374,551 E917K probably damaging Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fnbp4 G T 2: 90,757,404 L375F probably damaging Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Glt1d1 A G 5: 127,657,112 M117V probably benign Het
Hcar1 A C 5: 123,878,586 D347E probably benign Het
Kif16b T C 2: 142,740,917 K563E probably damaging Het
Klra17 A G 6: 129,874,794 probably null Het
Krt35 C T 11: 100,095,767 M140I probably benign Het
Lamb2 A T 9: 108,480,610 I111F probably damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Noa1 G A 5: 77,309,804 Q85* probably null Het
Nsun4 A T 4: 116,052,950 S138T probably benign Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pde1a T A 2: 80,128,931 probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhj1 A T 10: 80,796,472 N55K probably benign Het
Ptpn20 A G 14: 33,612,311 M49V probably benign Het
Rbm6 A G 9: 107,791,090 L547P probably damaging Het
Rexo1 C T 10: 80,549,569 E552K probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Setd2 A G 9: 110,561,243 probably benign Het
Slc22a28 T C 19: 8,071,208 Y358C probably benign Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Tcirg1 C T 19: 3,903,591 R112H possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Trpc1 T A 9: 95,706,933 N746I probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Vmn1r68 T C 7: 10,527,445 E242G probably damaging Het
Vmn2r29 T A 7: 7,240,086 H22L possibly damaging Het
Vmn2r32 T A 7: 7,474,619 I258L probably benign Het
Vmn2r37 T A 7: 9,217,944 T307S probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vmn2r67 T C 7: 85,136,974 T608A probably damaging Het
Xpo1 T A 11: 23,284,634 probably null Het
Zfp180 T G 7: 24,104,624 V156G probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Other mutations in Col1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Col1a2 APN 6 4531095 splice site probably benign
IGL01126:Col1a2 APN 6 4535846 missense unknown
IGL01129:Col1a2 APN 6 4535846 missense unknown
IGL01286:Col1a2 APN 6 4533891 missense unknown
IGL01687:Col1a2 APN 6 4520258 nonsense probably null
IGL01866:Col1a2 APN 6 4524132 missense probably damaging 1.00
IGL02010:Col1a2 APN 6 4512416 critical splice donor site probably null
IGL02100:Col1a2 APN 6 4524177 splice site probably benign
IGL02140:Col1a2 APN 6 4515639 missense unknown
IGL02474:Col1a2 APN 6 4516398 missense unknown
IGL02510:Col1a2 APN 6 4516398 missense unknown
IGL02525:Col1a2 APN 6 4531355 splice site probably benign
IGL02839:Col1a2 APN 6 4538748 missense unknown
IGL03134:Col1a2 APN 6 4521387 unclassified probably benign
IGL03385:Col1a2 APN 6 4539612 missense unknown
P4717OSA:Col1a2 UTSW 6 4518822 unclassified probably benign
PIT4453001:Col1a2 UTSW 6 4527079 missense possibly damaging 0.94
R0021:Col1a2 UTSW 6 4518822 unclassified probably benign
R0022:Col1a2 UTSW 6 4518822 unclassified probably benign
R0025:Col1a2 UTSW 6 4518822 unclassified probably benign
R0027:Col1a2 UTSW 6 4518822 unclassified probably benign
R0028:Col1a2 UTSW 6 4518822 unclassified probably benign
R0031:Col1a2 UTSW 6 4518822 unclassified probably benign
R0038:Col1a2 UTSW 6 4518822 unclassified probably benign
R0064:Col1a2 UTSW 6 4518822 unclassified probably benign
R0102:Col1a2 UTSW 6 4520775 missense possibly damaging 0.92
R0147:Col1a2 UTSW 6 4518822 unclassified probably benign
R0323:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4537838 missense unknown
R0335:Col1a2 UTSW 6 4531956 splice site probably benign
R0359:Col1a2 UTSW 6 4518822 unclassified probably benign
R0363:Col1a2 UTSW 6 4518822 unclassified probably benign
R0612:Col1a2 UTSW 6 4516003 missense unknown
R0729:Col1a2 UTSW 6 4518822 unclassified probably benign
R0746:Col1a2 UTSW 6 4518822 unclassified probably benign
R0760:Col1a2 UTSW 6 4518822 unclassified probably benign
R0761:Col1a2 UTSW 6 4518822 unclassified probably benign
R0801:Col1a2 UTSW 6 4531316 missense unknown
R0845:Col1a2 UTSW 6 4518822 unclassified probably benign
R0846:Col1a2 UTSW 6 4518822 unclassified probably benign
R0969:Col1a2 UTSW 6 4518822 unclassified probably benign
R0970:Col1a2 UTSW 6 4518822 unclassified probably benign
R1105:Col1a2 UTSW 6 4518822 unclassified probably benign
R1106:Col1a2 UTSW 6 4518822 unclassified probably benign
R1107:Col1a2 UTSW 6 4518822 unclassified probably benign
R1134:Col1a2 UTSW 6 4518822 unclassified probably benign
R1135:Col1a2 UTSW 6 4518822 unclassified probably benign
R1152:Col1a2 UTSW 6 4518822 unclassified probably benign
R1333:Col1a2 UTSW 6 4515684 critical splice donor site probably null
R1341:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1477:Col1a2 UTSW 6 4539673 missense unknown
R1566:Col1a2 UTSW 6 4523613 missense probably damaging 1.00
R1691:Col1a2 UTSW 6 4536038 missense unknown
R1713:Col1a2 UTSW 6 4538691 missense unknown
R1754:Col1a2 UTSW 6 4518822 unclassified probably benign
R1755:Col1a2 UTSW 6 4518822 unclassified probably benign
R2050:Col1a2 UTSW 6 4518822 unclassified probably benign
R2178:Col1a2 UTSW 6 4531143 missense unknown
R2194:Col1a2 UTSW 6 4518822 unclassified probably benign
R2195:Col1a2 UTSW 6 4518822 unclassified probably benign
R2235:Col1a2 UTSW 6 4518822 unclassified probably benign
R2261:Col1a2 UTSW 6 4518822 unclassified probably benign
R2263:Col1a2 UTSW 6 4518822 unclassified probably benign
R2289:Col1a2 UTSW 6 4518822 unclassified probably benign
R2310:Col1a2 UTSW 6 4518822 unclassified probably benign
R2312:Col1a2 UTSW 6 4518822 unclassified probably benign
R2330:Col1a2 UTSW 6 4528300 splice site probably benign
R2333:Col1a2 UTSW 6 4532747 missense unknown
R2401:Col1a2 UTSW 6 4518822 unclassified probably benign
R2403:Col1a2 UTSW 6 4518822 unclassified probably benign
R2448:Col1a2 UTSW 6 4518822 unclassified probably benign
R2513:Col1a2 UTSW 6 4531223 splice site probably null
R2862:Col1a2 UTSW 6 4518822 unclassified probably benign
R2884:Col1a2 UTSW 6 4518822 unclassified probably benign
R2885:Col1a2 UTSW 6 4518822 unclassified probably benign
R2913:Col1a2 UTSW 6 4519923 unclassified probably benign
R2937:Col1a2 UTSW 6 4519882 unclassified probably benign
R2937:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R2938:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R3608:Col1a2 UTSW 6 4518822 unclassified probably benign
R3692:Col1a2 UTSW 6 4510710 missense possibly damaging 0.84
R3805:Col1a2 UTSW 6 4518822 unclassified probably benign
R3806:Col1a2 UTSW 6 4518822 unclassified probably benign
R3826:Col1a2 UTSW 6 4516960 unclassified probably benign
R3903:Col1a2 UTSW 6 4518822 unclassified probably benign
R3904:Col1a2 UTSW 6 4518822 unclassified probably benign
R3922:Col1a2 UTSW 6 4518822 unclassified probably benign
R3926:Col1a2 UTSW 6 4518822 unclassified probably benign
R4106:Col1a2 UTSW 6 4518822 unclassified probably benign
R4107:Col1a2 UTSW 6 4518822 unclassified probably benign
R4108:Col1a2 UTSW 6 4518822 unclassified probably benign
R4109:Col1a2 UTSW 6 4510705 nonsense probably null
R4509:Col1a2 UTSW 6 4518822 unclassified probably benign
R4667:Col1a2 UTSW 6 4512412 missense unknown
R4909:Col1a2 UTSW 6 4529058 splice site probably benign
R5418:Col1a2 UTSW 6 4516931 unclassified probably benign
R5587:Col1a2 UTSW 6 4540531 missense unknown
R5598:Col1a2 UTSW 6 4516916 unclassified probably benign
R5673:Col1a2 UTSW 6 4539622 missense unknown
R5678:Col1a2 UTSW 6 4536239 missense unknown
R5763:Col1a2 UTSW 6 4515682 missense unknown
R5786:Col1a2 UTSW 6 4530223 missense unknown
R5872:Col1a2 UTSW 6 4531926 missense unknown
R6084:Col1a2 UTSW 6 4505840 start codon destroyed probably benign 0.01
R6134:Col1a2 UTSW 6 4538035 missense unknown
R6221:Col1a2 UTSW 6 4539490 missense unknown
R6481:Col1a2 UTSW 6 4538680 missense unknown
R6500:Col1a2 UTSW 6 4515517 missense unknown
R6890:Col1a2 UTSW 6 4539587 missense unknown
R7022:Col1a2 UTSW 6 4534639 missense unknown
R7033:Col1a2 UTSW 6 4516904 unclassified probably benign
R7195:Col1a2 UTSW 6 4510753 missense unknown
R7657:Col1a2 UTSW 6 4527152 missense probably null 0.99
R7686:Col1a2 UTSW 6 4518964 missense unknown
R7875:Col1a2 UTSW 6 4518500 missense unknown
R8023:Col1a2 UTSW 6 4533847 missense unknown
R8208:Col1a2 UTSW 6 4515260 splice site probably null
R8277:Col1a2 UTSW 6 4516410 missense probably null
R8438:Col1a2 UTSW 6 4515517 missense unknown
R8438:Col1a2 UTSW 6 4515518 missense unknown
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
X0017:Col1a2 UTSW 6 4515675 missense unknown
Z1176:Col1a2 UTSW 6 4532750 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGAATGTGCATGCTTAGC -3'
(R):5'- TGTCAGGACTTACAGCAGGG -3'

Sequencing Primer
(F):5'- GAGACTTTGATAATTGCTATCTCCC -3'
(R):5'- ACTTACAGCAGGGCCGAC -3'
Posted On2014-10-16