Mutagenetix > Incidental Mutations

Incidental Mutation 'R2262:Col1a2'

243858

Institutional Source

Beutler Lab

Gene Symbol

Col1a2

Ensembl Gene

ENSMUSG00000029661

Gene Name

collagen, type I, alpha 2

Synonyms

Cola2, Cola-2, Col1a-2

MMRRC Submission

040262-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2262 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4504814-4541544 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 4518822 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031668] [ENSMUST00000141483]

Predicted Effect

unknown
Transcript: ENSMUST00000031668
AA Change: R230H

SMART Domains

Protein: ENSMUSP00000031668
Gene: ENSMUSG00000029661
AA Change: R230H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Collagen	30	91	1e-8	PFAM
Pfam:Collagen	88	155	8.2e-10	PFAM
internal_repeat_3	172	223	7.52e-12	PROSPERO
low complexity region	225	271	N/A	INTRINSIC
low complexity region	274	313	N/A	INTRINSIC
low complexity region	316	352	N/A	INTRINSIC
internal_repeat_2	354	386	2.06e-15	PROSPERO
internal_repeat_1	355	469	5.71e-17	PROSPERO
internal_repeat_4	361	472	2.1e-11	PROSPERO
Pfam:Collagen	475	535	7.7e-11	PFAM
Pfam:Collagen	521	588	8.2e-10	PFAM
low complexity region	598	625	N/A	INTRINSIC
low complexity region	628	655	N/A	INTRINSIC
low complexity region	679	722	N/A	INTRINSIC
low complexity region	724	757	N/A	INTRINSIC
low complexity region	759	784	N/A	INTRINSIC
low complexity region	792	820	N/A	INTRINSIC
internal_repeat_5	823	850	5.93e-7	PROSPERO
low complexity region	853	883	N/A	INTRINSIC
Pfam:Collagen	895	969	1e-8	PFAM
low complexity region	987	1007	N/A	INTRINSIC
internal_repeat_5	1009	1042	5.93e-7	PROSPERO
Pfam:Collagen	1051	1120	5.8e-9	PFAM
COLFI	1138	1372	2.1e-150	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132029

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138511

Predicted Effect

probably benign
Transcript: ENSMUST00000141483

SMART Domains

Protein: ENSMUSP00000125275
Gene: ENSMUSG00000029661

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Collagen	30	89	3.2e-10	PFAM
Pfam:Collagen	87	145	8.5e-10	PFAM
Pfam:Collagen	121	177	3.3e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148864

Meta Mutation Damage Score

0.1176

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-1 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice harboring certain mutations in the encoded gene exhibit symptoms of moderate to severe forms of osteogenesis imperfecta. [provided by RefSeq, Dec 2015]
PHENOTYPE: The tails of mice heterozygous for an ENU-induced mutation at this locus are flexible or rubbery. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	T	C	7: 29,532,562		noncoding transcript	Het
Ahdc1	A	G	4: 133,063,163	T572A	unknown	Het
Bco1	T	C	8: 117,133,025	L489S	probably damaging	Het
Brinp1	A	G	4: 68,829,354	Y171H	probably damaging	Het
C1rl	A	T	6: 124,506,948	I186F	probably damaging	Het
Cacna1d	A	G	14: 30,491,016	V29A	possibly damaging	Het
Calcrl	T	C	2: 84,345,173	D279G	probably damaging	Het
Cass4	T	C	2: 172,427,254	S421P	probably damaging	Het
Casz1	G	T	4: 148,929,099	R40L	probably damaging	Het
Cdh23	A	G	10: 60,317,128	V2372A	probably damaging	Het
Cdk17	T	A	10: 93,211,958	S56T	possibly damaging	Het
Ces2h	T	A	8: 105,016,559	M142K	probably damaging	Het
Cfap161	C	T	7: 83,793,372	V78I	probably benign	Het
Chst8	T	A	7: 34,676,010	M135L	probably benign	Het
Dcc	C	T	18: 71,374,551	E917K	probably damaging	Het
Dnah11	T	C	12: 117,966,639	T3324A	probably damaging	Het
Dnah11	T	A	12: 117,880,025	M4362L	probably benign	Het
Dnah8	A	G	17: 30,673,835	N798S	probably damaging	Het
Dnajc3	A	G	14: 118,960,820	Q118R	probably damaging	Het
Dok4	A	T	8: 94,866,512	C182S	probably damaging	Het
Fnbp4	G	T	2: 90,757,404	L375F	probably damaging	Het
Gbp8	T	C	5: 105,016,133	Q433R	possibly damaging	Het
Glt1d1	A	G	5: 127,657,112	M117V	probably benign	Het
Hcar1	A	C	5: 123,878,586	D347E	probably benign	Het
Kif16b	T	C	2: 142,740,917	K563E	probably damaging	Het
Klra17	A	G	6: 129,874,794		probably null	Het
Krt35	C	T	11: 100,095,767	M140I	probably benign	Het
Lamb2	A	T	9: 108,480,610	I111F	probably damaging	Het
Nell1	C	T	7: 50,560,821	T494I	possibly damaging	Het
Noa1	G	A	5: 77,309,804	Q85*	probably null	Het
Nsun4	A	T	4: 116,052,950	S138T	probably benign	Het
Pcdh1	A	T	18: 38,198,657	L431H	probably benign	Het
Pde1a	T	A	2: 80,128,931		probably benign	Het
Pdgfra	T	C	5: 75,185,523	V778A	probably benign	Het
Plekhj1	A	T	10: 80,796,472	N55K	probably benign	Het
Ptpn20	A	G	14: 33,612,311	M49V	probably benign	Het
Rbm6	A	G	9: 107,791,090	L547P	probably damaging	Het
Rexo1	C	T	10: 80,549,569	E552K	probably benign	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Saxo1	C	T	4: 86,478,975	D109N	probably damaging	Het
Setd2	A	G	9: 110,561,243		probably benign	Het
Slc22a28	T	C	19: 8,071,208	Y358C	probably benign	Het
Sptbn4	T	A	7: 27,434,357	D77V	probably damaging	Het
Ssh1	T	C	5: 113,942,703	S867G	possibly damaging	Het
Stmn2	T	C	3: 8,541,895	F25S	probably damaging	Het
Tcirg1	C	T	19: 3,903,591	R112H	possibly damaging	Het
Tekt4	T	A	17: 25,476,511	S439R	possibly damaging	Het
Trpc1	T	A	9: 95,706,933	N746I	probably damaging	Het
Tuba1c	A	G	15: 99,037,876	H406R	probably damaging	Het
Uqcrfs1	G	A	13: 30,541,107	S150L	probably benign	Het
Vcp	T	C	4: 42,980,828	T761A	probably benign	Het
Vmn1r68	T	C	7: 10,527,445	E242G	probably damaging	Het
Vmn2r29	T	A	7: 7,240,086	H22L	possibly damaging	Het
Vmn2r32	T	A	7: 7,474,619	I258L	probably benign	Het
Vmn2r37	T	A	7: 9,217,944	T307S	probably damaging	Het
Vmn2r6	T	C	3: 64,556,669	N248S	probably benign	Het
Vmn2r63	G	T	7: 42,928,607	T169N	probably benign	Het
Vmn2r67	T	C	7: 85,136,974	T608A	probably damaging	Het
Xpo1	T	A	11: 23,284,634		probably null	Het
Zfp180	T	G	7: 24,104,624	V156G	probably benign	Het
Zfp37	A	T	4: 62,191,636	L397Q	probably damaging	Het

Other mutations in Col1a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Col1a2	APN	6	4531095	splice site	probably benign
IGL01126:Col1a2	APN	6	4535846	missense	unknown
IGL01129:Col1a2	APN	6	4535846	missense	unknown
IGL01286:Col1a2	APN	6	4533891	missense	unknown
IGL01687:Col1a2	APN	6	4520258	nonsense	probably null
IGL01866:Col1a2	APN	6	4524132	missense	probably damaging	1.00
IGL02010:Col1a2	APN	6	4512416	critical splice donor site	probably null
IGL02100:Col1a2	APN	6	4524177	splice site	probably benign
IGL02140:Col1a2	APN	6	4515639	missense	unknown
IGL02474:Col1a2	APN	6	4516398	missense	unknown
IGL02510:Col1a2	APN	6	4516398	missense	unknown
IGL02525:Col1a2	APN	6	4531355	splice site	probably benign
IGL02839:Col1a2	APN	6	4538748	missense	unknown
IGL03134:Col1a2	APN	6	4521387	unclassified	probably benign
IGL03385:Col1a2	APN	6	4539612	missense	unknown
P4717OSA:Col1a2	UTSW	6	4518822	unclassified	probably benign
PIT4453001:Col1a2	UTSW	6	4527079	missense	possibly damaging	0.94
R0021:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0022:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0025:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0027:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0028:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0031:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0038:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0064:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0102:Col1a2	UTSW	6	4520775	missense	possibly damaging	0.92
R0147:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0323:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0326:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0326:Col1a2	UTSW	6	4537838	missense	unknown
R0335:Col1a2	UTSW	6	4531956	splice site	probably benign
R0359:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0363:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0612:Col1a2	UTSW	6	4516003	missense	unknown
R0729:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0746:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0760:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0761:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0801:Col1a2	UTSW	6	4531316	missense	unknown
R0845:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0846:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0969:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0970:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1105:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1106:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1107:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1134:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1135:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1152:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1333:Col1a2	UTSW	6	4515684	critical splice donor site	probably null
R1341:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1470:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1470:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1477:Col1a2	UTSW	6	4539673	missense	unknown
R1566:Col1a2	UTSW	6	4523613	missense	probably damaging	1.00
R1691:Col1a2	UTSW	6	4536038	missense	unknown
R1713:Col1a2	UTSW	6	4538691	missense	unknown
R1754:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1755:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2050:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2178:Col1a2	UTSW	6	4531143	missense	unknown
R2194:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2195:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2235:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2261:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2263:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2289:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2310:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2312:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2330:Col1a2	UTSW	6	4528300	splice site	probably benign
R2333:Col1a2	UTSW	6	4532747	missense	unknown
R2401:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2403:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2448:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2513:Col1a2	UTSW	6	4531223	splice site	probably null
R2862:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2884:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2885:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2913:Col1a2	UTSW	6	4519923	unclassified	probably benign
R2937:Col1a2	UTSW	6	4519882	unclassified	probably benign
R2937:Col1a2	UTSW	6	4520788	missense	possibly damaging	0.92
R2938:Col1a2	UTSW	6	4520788	missense	possibly damaging	0.92
R3608:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3692:Col1a2	UTSW	6	4510710	missense	possibly damaging	0.84
R3805:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3806:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3826:Col1a2	UTSW	6	4516960	unclassified	probably benign
R3903:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3904:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3922:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3926:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4106:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4107:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4108:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4109:Col1a2	UTSW	6	4510705	nonsense	probably null
R4509:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4667:Col1a2	UTSW	6	4512412	missense	unknown
R4909:Col1a2	UTSW	6	4529058	splice site	probably benign
R5418:Col1a2	UTSW	6	4516931	unclassified	probably benign
R5587:Col1a2	UTSW	6	4540531	missense	unknown
R5598:Col1a2	UTSW	6	4516916	unclassified	probably benign
R5673:Col1a2	UTSW	6	4539622	missense	unknown
R5678:Col1a2	UTSW	6	4536239	missense	unknown
R5763:Col1a2	UTSW	6	4515682	missense	unknown
R5786:Col1a2	UTSW	6	4530223	missense	unknown
R5872:Col1a2	UTSW	6	4531926	missense	unknown
R6084:Col1a2	UTSW	6	4505840	start codon destroyed	probably benign	0.01
R6134:Col1a2	UTSW	6	4538035	missense	unknown
R6221:Col1a2	UTSW	6	4539490	missense	unknown
R6481:Col1a2	UTSW	6	4538680	missense	unknown
R6500:Col1a2	UTSW	6	4515517	missense	unknown
R6890:Col1a2	UTSW	6	4539587	missense	unknown
R7022:Col1a2	UTSW	6	4534639	missense	unknown
R7033:Col1a2	UTSW	6	4516904	unclassified	probably benign
R7195:Col1a2	UTSW	6	4510753	missense	unknown
R7657:Col1a2	UTSW	6	4527152	missense	probably null	0.99
R7686:Col1a2	UTSW	6	4518964	missense	unknown
R7875:Col1a2	UTSW	6	4518500	missense	unknown
R8023:Col1a2	UTSW	6	4533847	missense	unknown
R8208:Col1a2	UTSW	6	4515260	splice site	probably null
R8277:Col1a2	UTSW	6	4516410	missense	probably null
R8438:Col1a2	UTSW	6	4515517	missense	unknown
R8438:Col1a2	UTSW	6	4515518	missense	unknown
V5622:Col1a2	UTSW	6	4518822	unclassified	probably benign
V5622:Col1a2	UTSW	6	4518822	unclassified	probably benign
X0017:Col1a2	UTSW	6	4515675	missense	unknown
Z1176:Col1a2	UTSW	6	4532750	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCTGAATGTGCATGCTTAGC -3'
(R):5'- TGTCAGGACTTACAGCAGGG -3'

Sequencing Primer
(F):5'- GAGACTTTGATAATTGCTATCTCCC -3'
(R):5'- ACTTACAGCAGGGCCGAC -3'

Posted On

2014-10-16