Mutagenetix > Incidental Mutations

Incidental Mutation 'R2262:Ces2h'

243876

Institutional Source

Beutler Lab

Gene Symbol

Ces2h

Ensembl Gene

ENSMUSG00000091813

Gene Name

carboxylesterase 2H

Synonyms

Gm5744

MMRRC Submission

040262-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R2262 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105000853-105021178 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105016559 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 142 (M142K)

Ref Sequence

ENSEMBL: ENSMUSP00000126773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172032]

Predicted Effect

probably damaging
Transcript: ENSMUST00000172032
AA Change: M142K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126773
Gene: ENSMUSG00000091813
AA Change: M142K

Domain	Start	End	E-Value	Type
Pfam:COesterase	9	537	2.5e-167	PFAM
Pfam:Abhydrolase_3	142	275	4.1e-11	PFAM
Pfam:Peptidase_S9	161	326	3.3e-8	PFAM
coiled coil region	538	558	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212347

Meta Mutation Damage Score

0.2595

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	T	C	7: 29,532,562		noncoding transcript	Het
Ahdc1	A	G	4: 133,063,163	T572A	unknown	Het
Bco1	T	C	8: 117,133,025	L489S	probably damaging	Het
Brinp1	A	G	4: 68,829,354	Y171H	probably damaging	Het
C1rl	A	T	6: 124,506,948	I186F	probably damaging	Het
Cacna1d	A	G	14: 30,491,016	V29A	possibly damaging	Het
Calcrl	T	C	2: 84,345,173	D279G	probably damaging	Het
Cass4	T	C	2: 172,427,254	S421P	probably damaging	Het
Casz1	G	T	4: 148,929,099	R40L	probably damaging	Het
Cdh23	A	G	10: 60,317,128	V2372A	probably damaging	Het
Cdk17	T	A	10: 93,211,958	S56T	possibly damaging	Het
Cfap161	C	T	7: 83,793,372	V78I	probably benign	Het
Chst8	T	A	7: 34,676,010	M135L	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Dcc	C	T	18: 71,374,551	E917K	probably damaging	Het
Dnah11	T	A	12: 117,880,025	M4362L	probably benign	Het
Dnah11	T	C	12: 117,966,639	T3324A	probably damaging	Het
Dnah8	A	G	17: 30,673,835	N798S	probably damaging	Het
Dnajc3	A	G	14: 118,960,820	Q118R	probably damaging	Het
Dok4	A	T	8: 94,866,512	C182S	probably damaging	Het
Fnbp4	G	T	2: 90,757,404	L375F	probably damaging	Het
Gbp8	T	C	5: 105,016,133	Q433R	possibly damaging	Het
Glt1d1	A	G	5: 127,657,112	M117V	probably benign	Het
Hcar1	A	C	5: 123,878,586	D347E	probably benign	Het
Kif16b	T	C	2: 142,740,917	K563E	probably damaging	Het
Klra17	A	G	6: 129,874,794		probably null	Het
Krt35	C	T	11: 100,095,767	M140I	probably benign	Het
Lamb2	A	T	9: 108,480,610	I111F	probably damaging	Het
Nell1	C	T	7: 50,560,821	T494I	possibly damaging	Het
Noa1	G	A	5: 77,309,804	Q85*	probably null	Het
Nsun4	A	T	4: 116,052,950	S138T	probably benign	Het
Pcdh1	A	T	18: 38,198,657	L431H	probably benign	Het
Pde1a	T	A	2: 80,128,931		probably benign	Het
Pdgfra	T	C	5: 75,185,523	V778A	probably benign	Het
Plekhj1	A	T	10: 80,796,472	N55K	probably benign	Het
Ptpn20	A	G	14: 33,612,311	M49V	probably benign	Het
Rbm6	A	G	9: 107,791,090	L547P	probably damaging	Het
Rexo1	C	T	10: 80,549,569	E552K	probably benign	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Saxo1	C	T	4: 86,478,975	D109N	probably damaging	Het
Setd2	A	G	9: 110,561,243		probably benign	Het
Slc22a28	T	C	19: 8,071,208	Y358C	probably benign	Het
Sptbn4	T	A	7: 27,434,357	D77V	probably damaging	Het
Ssh1	T	C	5: 113,942,703	S867G	possibly damaging	Het
Stmn2	T	C	3: 8,541,895	F25S	probably damaging	Het
Tcirg1	C	T	19: 3,903,591	R112H	possibly damaging	Het
Tekt4	T	A	17: 25,476,511	S439R	possibly damaging	Het
Trpc1	T	A	9: 95,706,933	N746I	probably damaging	Het
Tuba1c	A	G	15: 99,037,876	H406R	probably damaging	Het
Uqcrfs1	G	A	13: 30,541,107	S150L	probably benign	Het
Vcp	T	C	4: 42,980,828	T761A	probably benign	Het
Vmn1r68	T	C	7: 10,527,445	E242G	probably damaging	Het
Vmn2r29	T	A	7: 7,240,086	H22L	possibly damaging	Het
Vmn2r32	T	A	7: 7,474,619	I258L	probably benign	Het
Vmn2r37	T	A	7: 9,217,944	T307S	probably damaging	Het
Vmn2r6	T	C	3: 64,556,669	N248S	probably benign	Het
Vmn2r63	G	T	7: 42,928,607	T169N	probably benign	Het
Vmn2r67	T	C	7: 85,136,974	T608A	probably damaging	Het
Xpo1	T	A	11: 23,284,634		probably null	Het
Zfp180	T	G	7: 24,104,624	V156G	probably benign	Het
Zfp37	A	T	4: 62,191,636	L397Q	probably damaging	Het

Other mutations in Ces2h

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01530:Ces2h	APN	8	105014484	missense	probably benign	0.01
IGL02268:Ces2h	APN	8	105019940	missense	probably benign	0.00
IGL03133:Ces2h	APN	8	105016779	missense	probably damaging	1.00
R0138:Ces2h	UTSW	8	105018061	missense	probably benign	0.01
R0294:Ces2h	UTSW	8	105016604	missense	probably benign	0.01
R0482:Ces2h	UTSW	8	105020271	missense	possibly damaging	0.48
R0899:Ces2h	UTSW	8	105014550	missense	probably damaging	1.00
R1232:Ces2h	UTSW	8	105014655	missense	probably benign	0.38
R1535:Ces2h	UTSW	8	105014486	missense	probably benign	0.06
R1738:Ces2h	UTSW	8	105019065	critical splice donor site	probably null
R1748:Ces2h	UTSW	8	105017841	missense	probably benign	0.00
R1759:Ces2h	UTSW	8	105016611	missense	probably damaging	1.00
R1778:Ces2h	UTSW	8	105014607	missense	possibly damaging	0.93
R1833:Ces2h	UTSW	8	105020373	missense	possibly damaging	0.93
R1999:Ces2h	UTSW	8	105020345	missense	probably benign	0.03
R2018:Ces2h	UTSW	8	105018398	missense	probably damaging	1.00
R2076:Ces2h	UTSW	8	105019028	missense	probably benign
R2261:Ces2h	UTSW	8	105016559	missense	probably damaging	0.99
R2356:Ces2h	UTSW	8	105015938	missense	probably damaging	0.98
R4453:Ces2h	UTSW	8	105014656	critical splice donor site	probably null
R4656:Ces2h	UTSW	8	105014639	missense	possibly damaging	0.80
R4732:Ces2h	UTSW	8	105014604	missense	probably damaging	0.97
R4733:Ces2h	UTSW	8	105014604	missense	probably damaging	0.97
R5219:Ces2h	UTSW	8	105016646	missense	probably damaging	1.00
R5400:Ces2h	UTSW	8	105018425	missense	probably benign	0.01
R5696:Ces2h	UTSW	8	105018979	missense	possibly damaging	0.69
R5894:Ces2h	UTSW	8	105019026	missense	probably benign	0.14
R6688:Ces2h	UTSW	8	105017840	missense	probably benign
R6711:Ces2h	UTSW	8	105018083	missense	probably benign	0.22
R6868:Ces2h	UTSW	8	105018423	missense	probably benign	0.02
R7233:Ces2h	UTSW	8	105017456	missense	probably damaging	0.99
R7516:Ces2h	UTSW	8	105016826	missense	probably damaging	1.00
R7710:Ces2h	UTSW	8	105000865	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTTTGATACTGGAGTCGACTAC -3'
(R):5'- CATCTCCAGTGCTGATAAATGGC -3'

Sequencing Primer
(F):5'- TTGATACTGGAGTCGACTACAAACAG -3'
(R):5'- GGAATCACAGGGCTATACTTACTCTG -3'

Posted On

2014-10-16