Incidental Mutation 'R2262:Ces2h'
ID243876
Institutional Source Beutler Lab
Gene Symbol Ces2h
Ensembl Gene ENSMUSG00000091813
Gene Namecarboxylesterase 2H
SynonymsGm5744
MMRRC Submission 040262-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2262 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105000853-105021178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105016559 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 142 (M142K)
Ref Sequence ENSEMBL: ENSMUSP00000126773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172032]
Predicted Effect probably damaging
Transcript: ENSMUST00000172032
AA Change: M142K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126773
Gene: ENSMUSG00000091813
AA Change: M142K

DomainStartEndE-ValueType
Pfam:COesterase 9 537 2.5e-167 PFAM
Pfam:Abhydrolase_3 142 275 4.1e-11 PFAM
Pfam:Peptidase_S9 161 326 3.3e-8 PFAM
coiled coil region 538 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212347
Meta Mutation Damage Score 0.2595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Brinp1 A G 4: 68,829,354 Y171H probably damaging Het
C1rl A T 6: 124,506,948 I186F probably damaging Het
Cacna1d A G 14: 30,491,016 V29A possibly damaging Het
Calcrl T C 2: 84,345,173 D279G probably damaging Het
Cass4 T C 2: 172,427,254 S421P probably damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Cfap161 C T 7: 83,793,372 V78I probably benign Het
Chst8 T A 7: 34,676,010 M135L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcc C T 18: 71,374,551 E917K probably damaging Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fnbp4 G T 2: 90,757,404 L375F probably damaging Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Glt1d1 A G 5: 127,657,112 M117V probably benign Het
Hcar1 A C 5: 123,878,586 D347E probably benign Het
Kif16b T C 2: 142,740,917 K563E probably damaging Het
Klra17 A G 6: 129,874,794 probably null Het
Krt35 C T 11: 100,095,767 M140I probably benign Het
Lamb2 A T 9: 108,480,610 I111F probably damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Noa1 G A 5: 77,309,804 Q85* probably null Het
Nsun4 A T 4: 116,052,950 S138T probably benign Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pde1a T A 2: 80,128,931 probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhj1 A T 10: 80,796,472 N55K probably benign Het
Ptpn20 A G 14: 33,612,311 M49V probably benign Het
Rbm6 A G 9: 107,791,090 L547P probably damaging Het
Rexo1 C T 10: 80,549,569 E552K probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Setd2 A G 9: 110,561,243 probably benign Het
Slc22a28 T C 19: 8,071,208 Y358C probably benign Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Tcirg1 C T 19: 3,903,591 R112H possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Trpc1 T A 9: 95,706,933 N746I probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Vmn1r68 T C 7: 10,527,445 E242G probably damaging Het
Vmn2r29 T A 7: 7,240,086 H22L possibly damaging Het
Vmn2r32 T A 7: 7,474,619 I258L probably benign Het
Vmn2r37 T A 7: 9,217,944 T307S probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vmn2r67 T C 7: 85,136,974 T608A probably damaging Het
Xpo1 T A 11: 23,284,634 probably null Het
Zfp180 T G 7: 24,104,624 V156G probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Other mutations in Ces2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Ces2h APN 8 105014484 missense probably benign 0.01
IGL02268:Ces2h APN 8 105019940 missense probably benign 0.00
IGL03133:Ces2h APN 8 105016779 missense probably damaging 1.00
R0138:Ces2h UTSW 8 105018061 missense probably benign 0.01
R0294:Ces2h UTSW 8 105016604 missense probably benign 0.01
R0482:Ces2h UTSW 8 105020271 missense possibly damaging 0.48
R0899:Ces2h UTSW 8 105014550 missense probably damaging 1.00
R1232:Ces2h UTSW 8 105014655 missense probably benign 0.38
R1535:Ces2h UTSW 8 105014486 missense probably benign 0.06
R1738:Ces2h UTSW 8 105019065 critical splice donor site probably null
R1748:Ces2h UTSW 8 105017841 missense probably benign 0.00
R1759:Ces2h UTSW 8 105016611 missense probably damaging 1.00
R1778:Ces2h UTSW 8 105014607 missense possibly damaging 0.93
R1833:Ces2h UTSW 8 105020373 missense possibly damaging 0.93
R1999:Ces2h UTSW 8 105020345 missense probably benign 0.03
R2018:Ces2h UTSW 8 105018398 missense probably damaging 1.00
R2076:Ces2h UTSW 8 105019028 missense probably benign
R2261:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2356:Ces2h UTSW 8 105015938 missense probably damaging 0.98
R4453:Ces2h UTSW 8 105014656 critical splice donor site probably null
R4656:Ces2h UTSW 8 105014639 missense possibly damaging 0.80
R4732:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R4733:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R5219:Ces2h UTSW 8 105016646 missense probably damaging 1.00
R5400:Ces2h UTSW 8 105018425 missense probably benign 0.01
R5696:Ces2h UTSW 8 105018979 missense possibly damaging 0.69
R5894:Ces2h UTSW 8 105019026 missense probably benign 0.14
R6688:Ces2h UTSW 8 105017840 missense probably benign
R6711:Ces2h UTSW 8 105018083 missense probably benign 0.22
R6868:Ces2h UTSW 8 105018423 missense probably benign 0.02
R7233:Ces2h UTSW 8 105017456 missense probably damaging 0.99
R7516:Ces2h UTSW 8 105016826 missense probably damaging 1.00
R7710:Ces2h UTSW 8 105000865 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTTTGATACTGGAGTCGACTAC -3'
(R):5'- CATCTCCAGTGCTGATAAATGGC -3'

Sequencing Primer
(F):5'- TTGATACTGGAGTCGACTACAAACAG -3'
(R):5'- GGAATCACAGGGCTATACTTACTCTG -3'
Posted On2014-10-16