Incidental Mutation 'R2262:Trpc1'
ID243878
Institutional Source Beutler Lab
Gene Symbol Trpc1
Ensembl Gene ENSMUSG00000032839
Gene Nametransient receptor potential cation channel, subfamily C, member 1
SynonymsTrrp1, Mtrp1, Trp1
MMRRC Submission 040262-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R2262 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95705082-95750375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95706933 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 746 (N746I)
Ref Sequence ENSEMBL: ENSMUSP00000139672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053785] [ENSMUST00000189137] [ENSMUST00000190497] [ENSMUST00000190604]
Predicted Effect probably damaging
Transcript: ENSMUST00000053785
AA Change: N712I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839
AA Change: N712I

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 2.6e-27 PFAM
transmembrane domain 367 386 N/A INTRINSIC
Pfam:Ion_trans 407 673 5.9e-17 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189137
AA Change: N746I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839
AA Change: N746I

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 1.8e-29 PFAM
transmembrane domain 367 386 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
Pfam:Ion_trans 441 661 1.2e-21 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190497
SMART Domains Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190604
SMART Domains Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Brinp1 A G 4: 68,829,354 Y171H probably damaging Het
C1rl A T 6: 124,506,948 I186F probably damaging Het
Cacna1d A G 14: 30,491,016 V29A possibly damaging Het
Calcrl T C 2: 84,345,173 D279G probably damaging Het
Cass4 T C 2: 172,427,254 S421P probably damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap161 C T 7: 83,793,372 V78I probably benign Het
Chst8 T A 7: 34,676,010 M135L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcc C T 18: 71,374,551 E917K probably damaging Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fnbp4 G T 2: 90,757,404 L375F probably damaging Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Glt1d1 A G 5: 127,657,112 M117V probably benign Het
Hcar1 A C 5: 123,878,586 D347E probably benign Het
Kif16b T C 2: 142,740,917 K563E probably damaging Het
Klra17 A G 6: 129,874,794 probably null Het
Krt35 C T 11: 100,095,767 M140I probably benign Het
Lamb2 A T 9: 108,480,610 I111F probably damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Noa1 G A 5: 77,309,804 Q85* probably null Het
Nsun4 A T 4: 116,052,950 S138T probably benign Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pde1a T A 2: 80,128,931 probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhj1 A T 10: 80,796,472 N55K probably benign Het
Ptpn20 A G 14: 33,612,311 M49V probably benign Het
Rbm6 A G 9: 107,791,090 L547P probably damaging Het
Rexo1 C T 10: 80,549,569 E552K probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Setd2 A G 9: 110,561,243 probably benign Het
Slc22a28 T C 19: 8,071,208 Y358C probably benign Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Tcirg1 C T 19: 3,903,591 R112H possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Vmn1r68 T C 7: 10,527,445 E242G probably damaging Het
Vmn2r29 T A 7: 7,240,086 H22L possibly damaging Het
Vmn2r32 T A 7: 7,474,619 I258L probably benign Het
Vmn2r37 T A 7: 9,217,944 T307S probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vmn2r67 T C 7: 85,136,974 T608A probably damaging Het
Xpo1 T A 11: 23,284,634 probably null Het
Zfp180 T G 7: 24,104,624 V156G probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Other mutations in Trpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Trpc1 APN 9 95726494 missense probably damaging 1.00
IGL02094:Trpc1 APN 9 95743281 missense probably damaging 1.00
IGL02412:Trpc1 APN 9 95736861 missense probably damaging 1.00
IGL02494:Trpc1 APN 9 95708307 missense probably damaging 1.00
IGL02943:Trpc1 APN 9 95708853 splice site probably benign
IGL03025:Trpc1 APN 9 95710260 missense probably damaging 1.00
IGL03221:Trpc1 APN 9 95706900 missense probably damaging 1.00
Enlarged UTSW 9 95721471 critical splice acceptor site probably null
luxus UTSW 9 95721132 critical splice donor site probably null
Magnified UTSW 9 95726437 missense probably damaging 1.00
PIT4581001:Trpc1 UTSW 9 95736921 missense probably benign 0.21
R0034:Trpc1 UTSW 9 95749761 missense probably damaging 0.98
R1973:Trpc1 UTSW 9 95723255 missense probably benign
R2033:Trpc1 UTSW 9 95706843 missense probably damaging 0.99
R2117:Trpc1 UTSW 9 95717584 missense probably damaging 1.00
R2910:Trpc1 UTSW 9 95749842 missense probably benign 0.00
R2918:Trpc1 UTSW 9 95723129 missense probably damaging 1.00
R3156:Trpc1 UTSW 9 95721132 critical splice donor site probably null
R3427:Trpc1 UTSW 9 95732196 missense probably benign 0.12
R4093:Trpc1 UTSW 9 95706865 missense probably benign 0.12
R4384:Trpc1 UTSW 9 95732108 missense probably benign 0.13
R4787:Trpc1 UTSW 9 95721415 missense probably benign 0.02
R5327:Trpc1 UTSW 9 95721471 critical splice acceptor site probably null
R5576:Trpc1 UTSW 9 95721324 missense probably damaging 0.97
R6320:Trpc1 UTSW 9 95721250 missense probably damaging 1.00
R6499:Trpc1 UTSW 9 95726437 missense probably damaging 1.00
R6714:Trpc1 UTSW 9 95723273 missense probably damaging 1.00
R7179:Trpc1 UTSW 9 95721144 missense possibly damaging 0.82
R7265:Trpc1 UTSW 9 95708275 missense probably benign
R8169:Trpc1 UTSW 9 95710270 nonsense probably null
R8288:Trpc1 UTSW 9 95721381 missense probably damaging 1.00
R8342:Trpc1 UTSW 9 95726548 missense probably damaging 1.00
X0026:Trpc1 UTSW 9 95732044 missense probably benign 0.36
Z1176:Trpc1 UTSW 9 95723216 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGCATATTTAGAAGTCCGAAAGCC -3'
(R):5'- TATTGTCTCTAGGGCTGAAGGATGAC -3'

Sequencing Primer
(F):5'- CAAGCAAATCCCTTATTTCATTTCGG -3'
(R):5'- ACATGATGGCAGATGTTTGTCTAGC -3'
Posted On2014-10-16