Mutagenetix > Incidental Mutations

Incidental Mutation 'R2262:Trpc1'

243878

Institutional Source

Beutler Lab

Gene Symbol

Trpc1

Ensembl Gene

ENSMUSG00000032839

Gene Name

transient receptor potential cation channel, subfamily C, member 1

Synonyms

Trrp1, Mtrp1, Trp1

MMRRC Submission

040262-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R2262 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95705082-95750375 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 95706933 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 746 (N746I)

Ref Sequence

ENSEMBL: ENSMUSP00000139672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053785] [ENSMUST00000189137] [ENSMUST00000190497] [ENSMUST00000190604]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053785
AA Change: N712I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839
AA Change: N712I

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	2.6e-27	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
Pfam:Ion_trans	407	673	5.9e-17	PFAM
coiled coil region	770	794	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000189137
AA Change: N746I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839
AA Change: N746I

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	1.8e-29	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
transmembrane domain	407	424	N/A	INTRINSIC
Pfam:Ion_trans	441	661	1.2e-21	PFAM
coiled coil region	770	794	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190497

SMART Domains

Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190604

SMART Domains

Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

Meta Mutation Damage Score

0.1044

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	T	C	7: 29,532,562		noncoding transcript	Het
Ahdc1	A	G	4: 133,063,163	T572A	unknown	Het
Bco1	T	C	8: 117,133,025	L489S	probably damaging	Het
Brinp1	A	G	4: 68,829,354	Y171H	probably damaging	Het
C1rl	A	T	6: 124,506,948	I186F	probably damaging	Het
Cacna1d	A	G	14: 30,491,016	V29A	possibly damaging	Het
Calcrl	T	C	2: 84,345,173	D279G	probably damaging	Het
Cass4	T	C	2: 172,427,254	S421P	probably damaging	Het
Casz1	G	T	4: 148,929,099	R40L	probably damaging	Het
Cdh23	A	G	10: 60,317,128	V2372A	probably damaging	Het
Cdk17	T	A	10: 93,211,958	S56T	possibly damaging	Het
Ces2h	T	A	8: 105,016,559	M142K	probably damaging	Het
Cfap161	C	T	7: 83,793,372	V78I	probably benign	Het
Chst8	T	A	7: 34,676,010	M135L	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Dcc	C	T	18: 71,374,551	E917K	probably damaging	Het
Dnah11	T	A	12: 117,880,025	M4362L	probably benign	Het
Dnah11	T	C	12: 117,966,639	T3324A	probably damaging	Het
Dnah8	A	G	17: 30,673,835	N798S	probably damaging	Het
Dnajc3	A	G	14: 118,960,820	Q118R	probably damaging	Het
Dok4	A	T	8: 94,866,512	C182S	probably damaging	Het
Fnbp4	G	T	2: 90,757,404	L375F	probably damaging	Het
Gbp8	T	C	5: 105,016,133	Q433R	possibly damaging	Het
Glt1d1	A	G	5: 127,657,112	M117V	probably benign	Het
Hcar1	A	C	5: 123,878,586	D347E	probably benign	Het
Kif16b	T	C	2: 142,740,917	K563E	probably damaging	Het
Klra17	A	G	6: 129,874,794		probably null	Het
Krt35	C	T	11: 100,095,767	M140I	probably benign	Het
Lamb2	A	T	9: 108,480,610	I111F	probably damaging	Het
Nell1	C	T	7: 50,560,821	T494I	possibly damaging	Het
Noa1	G	A	5: 77,309,804	Q85*	probably null	Het
Nsun4	A	T	4: 116,052,950	S138T	probably benign	Het
Pcdh1	A	T	18: 38,198,657	L431H	probably benign	Het
Pde1a	T	A	2: 80,128,931		probably benign	Het
Pdgfra	T	C	5: 75,185,523	V778A	probably benign	Het
Plekhj1	A	T	10: 80,796,472	N55K	probably benign	Het
Ptpn20	A	G	14: 33,612,311	M49V	probably benign	Het
Rbm6	A	G	9: 107,791,090	L547P	probably damaging	Het
Rexo1	C	T	10: 80,549,569	E552K	probably benign	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Saxo1	C	T	4: 86,478,975	D109N	probably damaging	Het
Setd2	A	G	9: 110,561,243		probably benign	Het
Slc22a28	T	C	19: 8,071,208	Y358C	probably benign	Het
Sptbn4	T	A	7: 27,434,357	D77V	probably damaging	Het
Ssh1	T	C	5: 113,942,703	S867G	possibly damaging	Het
Stmn2	T	C	3: 8,541,895	F25S	probably damaging	Het
Tcirg1	C	T	19: 3,903,591	R112H	possibly damaging	Het
Tekt4	T	A	17: 25,476,511	S439R	possibly damaging	Het
Tuba1c	A	G	15: 99,037,876	H406R	probably damaging	Het
Uqcrfs1	G	A	13: 30,541,107	S150L	probably benign	Het
Vcp	T	C	4: 42,980,828	T761A	probably benign	Het
Vmn1r68	T	C	7: 10,527,445	E242G	probably damaging	Het
Vmn2r29	T	A	7: 7,240,086	H22L	possibly damaging	Het
Vmn2r32	T	A	7: 7,474,619	I258L	probably benign	Het
Vmn2r37	T	A	7: 9,217,944	T307S	probably damaging	Het
Vmn2r6	T	C	3: 64,556,669	N248S	probably benign	Het
Vmn2r63	G	T	7: 42,928,607	T169N	probably benign	Het
Vmn2r67	T	C	7: 85,136,974	T608A	probably damaging	Het
Xpo1	T	A	11: 23,284,634		probably null	Het
Zfp180	T	G	7: 24,104,624	V156G	probably benign	Het
Zfp37	A	T	4: 62,191,636	L397Q	probably damaging	Het

Other mutations in Trpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Trpc1	APN	9	95726494	missense	probably damaging	1.00
IGL02094:Trpc1	APN	9	95743281	missense	probably damaging	1.00
IGL02412:Trpc1	APN	9	95736861	missense	probably damaging	1.00
IGL02494:Trpc1	APN	9	95708307	missense	probably damaging	1.00
IGL02943:Trpc1	APN	9	95708853	splice site	probably benign
IGL03025:Trpc1	APN	9	95710260	missense	probably damaging	1.00
IGL03221:Trpc1	APN	9	95706900	missense	probably damaging	1.00
Enlarged	UTSW	9	95721471	critical splice acceptor site	probably null
luxus	UTSW	9	95721132	critical splice donor site	probably null
Magnified	UTSW	9	95726437	missense	probably damaging	1.00
PIT4581001:Trpc1	UTSW	9	95736921	missense	probably benign	0.21
R0034:Trpc1	UTSW	9	95749761	missense	probably damaging	0.98
R1973:Trpc1	UTSW	9	95723255	missense	probably benign
R2033:Trpc1	UTSW	9	95706843	missense	probably damaging	0.99
R2117:Trpc1	UTSW	9	95717584	missense	probably damaging	1.00
R2910:Trpc1	UTSW	9	95749842	missense	probably benign	0.00
R2918:Trpc1	UTSW	9	95723129	missense	probably damaging	1.00
R3156:Trpc1	UTSW	9	95721132	critical splice donor site	probably null
R3427:Trpc1	UTSW	9	95732196	missense	probably benign	0.12
R4093:Trpc1	UTSW	9	95706865	missense	probably benign	0.12
R4384:Trpc1	UTSW	9	95732108	missense	probably benign	0.13
R4787:Trpc1	UTSW	9	95721415	missense	probably benign	0.02
R5327:Trpc1	UTSW	9	95721471	critical splice acceptor site	probably null
R5576:Trpc1	UTSW	9	95721324	missense	probably damaging	0.97
R6320:Trpc1	UTSW	9	95721250	missense	probably damaging	1.00
R6499:Trpc1	UTSW	9	95726437	missense	probably damaging	1.00
R6714:Trpc1	UTSW	9	95723273	missense	probably damaging	1.00
R7179:Trpc1	UTSW	9	95721144	missense	possibly damaging	0.82
R7265:Trpc1	UTSW	9	95708275	missense	probably benign
R8169:Trpc1	UTSW	9	95710270	nonsense	probably null
R8288:Trpc1	UTSW	9	95721381	missense	probably damaging	1.00
R8342:Trpc1	UTSW	9	95726548	missense	probably damaging	1.00
X0026:Trpc1	UTSW	9	95732044	missense	probably benign	0.36
Z1176:Trpc1	UTSW	9	95723216	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGCATATTTAGAAGTCCGAAAGCC -3'
(R):5'- TATTGTCTCTAGGGCTGAAGGATGAC -3'

Sequencing Primer
(F):5'- CAAGCAAATCCCTTATTTCATTTCGG -3'
(R):5'- ACATGATGGCAGATGTTTGTCTAGC -3'

Posted On

2014-10-16