Incidental Mutation 'R2262:Pcdh1'
ID243903
Institutional Source Beutler Lab
Gene Symbol Pcdh1
Ensembl Gene ENSMUSG00000051375
Gene Nameprotocadherin 1
Synonyms2010005A06Rik
MMRRC Submission 040262-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R2262 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38185914-38212053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38198657 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 431 (L431H)
Ref Sequence ENSEMBL: ENSMUSP00000125576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057185] [ENSMUST00000159405] [ENSMUST00000160721] [ENSMUST00000161701] [ENSMUST00000193828] [ENSMUST00000194312]
Predicted Effect probably benign
Transcript: ENSMUST00000057185
AA Change: L570H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000055199
Gene: ENSMUSG00000051375
AA Change: L570H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159405
AA Change: L570H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125309
Gene: ENSMUSG00000051375
AA Change: L570H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160721
SMART Domains Protein: ENSMUSP00000124732
Gene: ENSMUSG00000051375

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 9.9e-10 PFAM
CA 168 256 5.18e-18 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161701
AA Change: L431H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125576
Gene: ENSMUSG00000051375
AA Change: L431H

DomainStartEndE-ValueType
CA 29 117 5.18e-18 SMART
CA 141 224 5.68e-24 SMART
CA 256 343 1.84e-23 SMART
CA 367 449 2.99e-32 SMART
CA 473 552 9.36e-25 SMART
CA 578 659 9.9e-15 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 737 764 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 903 914 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193828
SMART Domains Protein: ENSMUSP00000142328
Gene: ENSMUSG00000051375

DomainStartEndE-ValueType
low complexity region 18 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194312
Meta Mutation Damage Score 0.4217 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin subfamily within the cadherin superfamily. The encoded protein is a membrane protein found at cell-cell boundaries. It is involved in neural cell adhesion, suggesting a possible role in neuronal development. The protein includes an extracelllular region, containing 7 cadherin-like domains, a transmembrane region and a C-terminal cytoplasmic region. Cells expressing the protein showed cell aggregation activity. Alternative splicing occurs in this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Brinp1 A G 4: 68,829,354 Y171H probably damaging Het
C1rl A T 6: 124,506,948 I186F probably damaging Het
Cacna1d A G 14: 30,491,016 V29A possibly damaging Het
Calcrl T C 2: 84,345,173 D279G probably damaging Het
Cass4 T C 2: 172,427,254 S421P probably damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap161 C T 7: 83,793,372 V78I probably benign Het
Chst8 T A 7: 34,676,010 M135L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcc C T 18: 71,374,551 E917K probably damaging Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fnbp4 G T 2: 90,757,404 L375F probably damaging Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Glt1d1 A G 5: 127,657,112 M117V probably benign Het
Hcar1 A C 5: 123,878,586 D347E probably benign Het
Kif16b T C 2: 142,740,917 K563E probably damaging Het
Klra17 A G 6: 129,874,794 probably null Het
Krt35 C T 11: 100,095,767 M140I probably benign Het
Lamb2 A T 9: 108,480,610 I111F probably damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Noa1 G A 5: 77,309,804 Q85* probably null Het
Nsun4 A T 4: 116,052,950 S138T probably benign Het
Pde1a T A 2: 80,128,931 probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhj1 A T 10: 80,796,472 N55K probably benign Het
Ptpn20 A G 14: 33,612,311 M49V probably benign Het
Rbm6 A G 9: 107,791,090 L547P probably damaging Het
Rexo1 C T 10: 80,549,569 E552K probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Setd2 A G 9: 110,561,243 probably benign Het
Slc22a28 T C 19: 8,071,208 Y358C probably benign Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Tcirg1 C T 19: 3,903,591 R112H possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Trpc1 T A 9: 95,706,933 N746I probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Vmn1r68 T C 7: 10,527,445 E242G probably damaging Het
Vmn2r29 T A 7: 7,240,086 H22L possibly damaging Het
Vmn2r32 T A 7: 7,474,619 I258L probably benign Het
Vmn2r37 T A 7: 9,217,944 T307S probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vmn2r67 T C 7: 85,136,974 T608A probably damaging Het
Xpo1 T A 11: 23,284,634 probably null Het
Zfp180 T G 7: 24,104,624 V156G probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Other mutations in Pcdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdh1 APN 18 38198729 missense possibly damaging 0.65
IGL00919:Pcdh1 APN 18 38202812 nonsense probably null
IGL01744:Pcdh1 APN 18 38203249 missense probably damaging 1.00
PIT4260001:Pcdh1 UTSW 18 38203366 missense probably damaging 0.99
R0542:Pcdh1 UTSW 18 38189922 missense probably damaging 0.99
R1449:Pcdh1 UTSW 18 38189876 missense probably damaging 0.99
R1540:Pcdh1 UTSW 18 38189726 missense probably benign 0.01
R1642:Pcdh1 UTSW 18 38199230 missense possibly damaging 0.84
R1672:Pcdh1 UTSW 18 38192180 missense probably damaging 1.00
R1695:Pcdh1 UTSW 18 38202868 missense probably damaging 1.00
R1727:Pcdh1 UTSW 18 38203032 nonsense probably null
R1781:Pcdh1 UTSW 18 38189924 missense probably damaging 1.00
R1793:Pcdh1 UTSW 18 38198885 missense probably damaging 0.99
R1839:Pcdh1 UTSW 18 38199485 missense possibly damaging 0.82
R1843:Pcdh1 UTSW 18 38192225 splice site probably null
R1882:Pcdh1 UTSW 18 38202842 missense possibly damaging 0.49
R2261:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2263:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2511:Pcdh1 UTSW 18 38199479 missense possibly damaging 0.95
R2937:Pcdh1 UTSW 18 38189762 missense probably benign 0.40
R3941:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R3942:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R4057:Pcdh1 UTSW 18 38198897 missense probably damaging 0.98
R4155:Pcdh1 UTSW 18 38203106 missense probably damaging 0.99
R4169:Pcdh1 UTSW 18 38198305 missense probably damaging 1.00
R4617:Pcdh1 UTSW 18 38197860 missense probably benign 0.00
R4690:Pcdh1 UTSW 18 38203475 missense probably benign 0.33
R4825:Pcdh1 UTSW 18 38189859 missense possibly damaging 0.77
R5201:Pcdh1 UTSW 18 38198918 missense probably damaging 0.98
R5266:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5267:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5351:Pcdh1 UTSW 18 38197766 missense probably damaging 1.00
R5568:Pcdh1 UTSW 18 38197367 missense probably damaging 1.00
R5729:Pcdh1 UTSW 18 38202946 missense probably damaging 1.00
R5731:Pcdh1 UTSW 18 38198598 missense probably damaging 1.00
R6043:Pcdh1 UTSW 18 38203274 missense probably damaging 0.97
R6278:Pcdh1 UTSW 18 38199210 missense probably benign 0.29
R6333:Pcdh1 UTSW 18 38198807 missense probably benign 0.25
R6498:Pcdh1 UTSW 18 38197437 missense probably benign 0.18
R6937:Pcdh1 UTSW 18 38203475 missense possibly damaging 0.86
R6994:Pcdh1 UTSW 18 38198500 missense probably damaging 1.00
R7242:Pcdh1 UTSW 18 38203217 missense probably benign 0.06
R7289:Pcdh1 UTSW 18 38189913 missense probably damaging 0.99
R7391:Pcdh1 UTSW 18 38202785 missense possibly damaging 0.95
R7702:Pcdh1 UTSW 18 38203516 missense unknown
R7738:Pcdh1 UTSW 18 38197476 missense probably benign 0.02
R7849:Pcdh1 UTSW 18 38189609 missense probably benign 0.01
R7941:Pcdh1 UTSW 18 38199080 missense probably damaging 1.00
R8109:Pcdh1 UTSW 18 38198996 missense probably damaging 1.00
R8675:Pcdh1 UTSW 18 38199176 missense probably damaging 1.00
X0027:Pcdh1 UTSW 18 38189788 nonsense probably null
Z1088:Pcdh1 UTSW 18 38198067 missense probably damaging 1.00
Z1176:Pcdh1 UTSW 18 38198688 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCCTGTGCCATTCTGGATAAC -3'
(R):5'- TGCTGACTCTGGCTCTAACG -3'

Sequencing Primer
(F):5'- CCTGTGCCATTCTGGATAACAAAGTC -3'
(R):5'- TAACGCAGAGCTAGTATACTCGCTG -3'
Posted On2014-10-16