Incidental Mutation 'R2263:Prex1'
ID243911
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
SynonymsP-REX1
MMRRC Submission 040263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R2263 (G1)
Quality Score145
Status Validated
Chromosome2
Chromosomal Location166566342-166713832 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 166589068 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080]
Predicted Effect probably benign
Transcript: ENSMUST00000036719
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099080
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
9130011E15Rik A G 19: 45,932,349 probably null Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Cryl1 G T 14: 57,286,408 Y232* probably null Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Fgf12 T A 16: 28,189,611 K84* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr1378 G A 11: 50,969,869 V284I possibly damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prim1 T A 10: 128,015,263 D5E probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Slx4ip T C 2: 137,044,015 I85T probably damaging Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166638401 missense probably damaging 1.00
IGL00309:Prex1 APN 2 166609823 missense probably damaging 0.99
IGL00953:Prex1 APN 2 166638409 missense probably damaging 1.00
IGL00961:Prex1 APN 2 166585736 missense probably damaging 0.98
IGL01300:Prex1 APN 2 166638407 missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166569340 splice site probably benign
IGL01753:Prex1 APN 2 166602882 missense probably benign 0.11
IGL01819:Prex1 APN 2 166621245 missense probably damaging 1.00
IGL02058:Prex1 APN 2 166585183 missense probably benign 0.00
IGL02251:Prex1 APN 2 166577886 missense probably damaging 0.99
IGL02326:Prex1 APN 2 166621185 missense probably benign 0.35
IGL02366:Prex1 APN 2 166580427 missense probably damaging 1.00
IGL02414:Prex1 APN 2 166609828 missense probably damaging 1.00
IGL02660:Prex1 APN 2 166593867 missense probably damaging 0.97
IGL02666:Prex1 APN 2 166572989 missense probably benign 0.00
IGL02874:Prex1 APN 2 166585047 missense probably damaging 1.00
IGL02935:Prex1 APN 2 166570345 missense probably damaging 1.00
IGL03179:Prex1 APN 2 166585194 missense probably benign 0.31
R0207:Prex1 UTSW 2 166585898 missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166586699 unclassified probably benign
R0420:Prex1 UTSW 2 166589571 missense probably benign 0.13
R0449:Prex1 UTSW 2 166569377 missense probably benign 0.16
R0458:Prex1 UTSW 2 166585823 missense probably damaging 0.99
R0927:Prex1 UTSW 2 166586537 missense probably benign 0.01
R1299:Prex1 UTSW 2 166585907 missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166593861 missense probably damaging 1.00
R1440:Prex1 UTSW 2 166580463 missense probably damaging 0.98
R1506:Prex1 UTSW 2 166587081 missense probably damaging 1.00
R1725:Prex1 UTSW 2 166601736 missense probably damaging 1.00
R1831:Prex1 UTSW 2 166585101 missense probably damaging 1.00
R1883:Prex1 UTSW 2 166583272 missense probably benign 0.20
R1896:Prex1 UTSW 2 166586654 missense probably benign 0.01
R2022:Prex1 UTSW 2 166575614 missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166569365 missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166587157 missense probably benign 0.00
R2276:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2279:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2680:Prex1 UTSW 2 166601772 missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166589036 missense probably benign 0.04
R3421:Prex1 UTSW 2 166617854 missense probably damaging 1.00
R3614:Prex1 UTSW 2 166609781 missense probably damaging 1.00
R4244:Prex1 UTSW 2 166570336 missense probably damaging 1.00
R4605:Prex1 UTSW 2 166713544 missense probably benign 0.45
R4685:Prex1 UTSW 2 166638332 missense probably damaging 0.97
R4787:Prex1 UTSW 2 166638340 missense probably benign 0.01
R4796:Prex1 UTSW 2 166592291 missense probably damaging 1.00
R4825:Prex1 UTSW 2 166585857 nonsense probably null
R4955:Prex1 UTSW 2 166573223 missense probably damaging 0.99
R5046:Prex1 UTSW 2 166572963 missense probably benign 0.00
R5095:Prex1 UTSW 2 166581921 missense probably damaging 1.00
R5408:Prex1 UTSW 2 166575653 small insertion probably benign
R5462:Prex1 UTSW 2 166644808 missense probably benign 0.02
R5535:Prex1 UTSW 2 166580273 missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166586659 missense probably damaging 1.00
R5813:Prex1 UTSW 2 166583207 missense probably benign
R5860:Prex1 UTSW 2 166644684 intron probably benign
R5984:Prex1 UTSW 2 166585744 missense probably damaging 1.00
R6009:Prex1 UTSW 2 166581984 missense probably damaging 1.00
R6174:Prex1 UTSW 2 166572963 missense probably benign 0.00
R6345:Prex1 UTSW 2 166572960 missense probably null 0.81
R6897:Prex1 UTSW 2 166581993 missense probably damaging 0.99
R6935:Prex1 UTSW 2 166599655 missense probably damaging 1.00
R7025:Prex1 UTSW 2 166613187 small insertion probably benign
R7037:Prex1 UTSW 2 166587180 missense probably benign 0.05
R7076:Prex1 UTSW 2 166633382 missense probably damaging 0.99
R7181:Prex1 UTSW 2 166570371 missense probably damaging 1.00
R7361:Prex1 UTSW 2 166713570 missense probably benign 0.04
R7381:Prex1 UTSW 2 166587127 missense probably damaging 1.00
R7721:Prex1 UTSW 2 166577890 nonsense probably null
R7763:Prex1 UTSW 2 166713709 missense unknown
R7809:Prex1 UTSW 2 166573244 missense possibly damaging 0.91
X0065:Prex1 UTSW 2 166586625 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAAGATGGGCCCTGCTCTG -3'
(R):5'- ACGCCTTCTCTTGACTTTGGAG -3'

Sequencing Primer
(F):5'- CCAACTGGGATGGATGGAGACC -3'
(R):5'- CTCTTGACTTTGGAGATTCAGGAGAG -3'
Posted On2014-10-16