Mutagenetix > Incidental Mutations

Incidental Mutation 'R2263:Folh1'

243923

Institutional Source

Beutler Lab

Gene Symbol

Folh1

Ensembl Gene

ENSMUSG00000001773

Gene Name

folate hydrolase 1

Synonyms

prostate-specific membrane antigen, glutamate carboxypeptidase II, mopsm, GCP2

MMRRC Submission

040263-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2263 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86718977-86775943 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86719765 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 685 (S685N)

Ref Sequence

ENSEMBL: ENSMUSP00000102892 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001824] [ENSMUST00000107271]

Predicted Effect

probably benign
Transcript: ENSMUST00000001824
AA Change: S718N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000001824
Gene: ENSMUSG00000001773
AA Change: S718N

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:PA	171	264	2.5e-16	PFAM
Pfam:Peptidase_M28	359	561	1.2e-18	PFAM
Pfam:TFR_dimer	629	749	1.6e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107271
AA Change: S685N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102892
Gene: ENSMUSG00000001773
AA Change: S685N

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:PA	167	265	7e-18	PFAM
Pfam:Peptidase_M28	339	475	2.1e-15	PFAM
Pfam:TFR_dimer	595	718	1.1e-43	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

PHENOTYPE: Homozygous mutation of this gene results in protection from peripheral neuropathy and ischemic brain injury. Homozygotes for a null allele show increased food intake, anxiety-like behavior, smaller sciatic nerve axons, and impaired angiogenesis. Homozygotes for a different null allele show less neuron degeneration and astrocyte damage after traumatic brain injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	T	C	7: 29,532,562		noncoding transcript	Het
9130011E15Rik	A	G	19: 45,932,349		probably null	Het
Abca13	T	C	11: 9,274,702	S472P	probably benign	Het
Arsi	T	C	18: 60,916,665	Y207H	probably damaging	Het
Atp2b4	C	T	1: 133,726,533	R778Q	probably benign	Het
Bdp1	T	A	13: 100,066,037	D693V	probably damaging	Het
Car12	C	A	9: 66,747,631	Y114*	probably null	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col4a1	A	G	8: 11,312,586		probably benign	Het
Cryl1	G	T	14: 57,286,408	Y232*	probably null	Het
Dnah11	T	A	12: 117,880,025	M4362L	probably benign	Het
Dnah11	T	C	12: 117,966,639	T3324A	probably damaging	Het
Dnah8	A	G	17: 30,673,835	N798S	probably damaging	Het
Dok4	A	T	8: 94,866,512	C182S	probably damaging	Het
Ehbp1	A	T	11: 22,095,462	N737K	probably benign	Het
Eif2b4	T	C	5: 31,192,574		probably benign	Het
Fat4	T	C	3: 38,888,989	V677A	possibly damaging	Het
Fbn2	A	G	18: 58,095,176		probably benign	Het
Fbxl3	G	T	14: 103,083,212	Y314*	probably null	Het
Fgf12	T	A	16: 28,189,611	K84*	probably null	Het
Flt3	G	A	5: 147,348,063	P748L	probably benign	Het
Gm13119	A	G	4: 144,363,541	I384V	probably benign	Het
Gpr65	A	T	12: 98,275,235	N49I	probably damaging	Het
Hdac7	A	G	15: 97,810,851		probably null	Het
Heatr5a	A	T	12: 51,916,150	V989E	probably damaging	Het
Ikbkap	A	G	4: 56,755,298		probably null	Het
Kif12	A	G	4: 63,169,521	S242P	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Mia3	A	G	1: 183,334,793	Y295H	probably benign	Het
Nell1	C	T	7: 50,560,821	T494I	possibly damaging	Het
Nmur2	A	T	11: 56,029,561	V286E	probably damaging	Het
Olfr1378	G	A	11: 50,969,869	V284I	possibly damaging	Het
Olfr20	T	A	11: 73,354,305	L184Q	possibly damaging	Het
Olfr574	T	C	7: 102,949,257	F254S	probably damaging	Het
Pcdh1	A	T	18: 38,198,657	L431H	probably benign	Het
Prex1	A	T	2: 166,589,068		probably benign	Het
Prim1	T	A	10: 128,015,263	D5E	probably benign	Het
Rubcnl	A	T	14: 75,040,820	N348I	possibly damaging	Het
Shisa9	G	T	16: 11,984,767	A63S	possibly damaging	Het
Shpk	G	A	11: 73,206,493		probably benign	Het
Slx4ip	T	C	2: 137,044,015	I85T	probably damaging	Het
Sptbn4	T	A	7: 27,434,357	D77V	probably damaging	Het
Strn3	A	T	12: 51,643,223		probably null	Het
Synrg	T	C	11: 83,977,152	M61T	possibly damaging	Het
Tekt4	T	A	17: 25,476,511	S439R	possibly damaging	Het
Ticam1	A	T	17: 56,271,888	V69E	possibly damaging	Het
Trpv1	C	T	11: 73,241,682	A374V	probably damaging	Het
Ubqln3	A	T	7: 104,141,635	L416*	probably null	Het
Uqcrfs1	G	A	13: 30,541,107	S150L	probably benign	Het
Utp15	T	C	13: 98,257,925	N153S	probably benign	Het
Vmn2r63	G	T	7: 42,928,607	T169N	probably benign	Het
Vps13b	T	A	15: 35,646,181	V1477E	probably benign	Het
Xpo1	T	A	11: 23,284,634		probably null	Het
Xpo5	A	G	17: 46,230,343	I769V	probably benign	Het
Zc3h14	A	T	12: 98,758,514	H252L	probably benign	Het
Zfp410	G	T	12: 84,323,020		probably null	Het
Zfp521	T	C	18: 13,846,240	E372G	possibly damaging	Het

Other mutations in Folh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Folh1	APN	7	86734143	missense	probably damaging	1.00
IGL00531:Folh1	APN	7	86719769	missense	possibly damaging	0.82
IGL00772:Folh1	APN	7	86731784	missense	probably damaging	1.00
IGL01339:Folh1	APN	7	86726098	missense	probably damaging	1.00
IGL01373:Folh1	APN	7	86746142	missense	probably benign	0.39
IGL01645:Folh1	APN	7	86742227	missense	probably damaging	1.00
IGL01736:Folh1	APN	7	86742236	missense	possibly damaging	0.96
IGL02104:Folh1	APN	7	86744430	missense	possibly damaging	0.93
IGL02124:Folh1	APN	7	86725418	missense	probably damaging	0.99
IGL02338:Folh1	APN	7	86736515	splice site	probably benign
IGL02440:Folh1	APN	7	86734104	missense	probably benign	0.09
IGL02689:Folh1	APN	7	86763045	splice site	probably null
IGL02976:Folh1	APN	7	86762918	missense	probably benign
IGL03022:Folh1	APN	7	86746171	missense	possibly damaging	0.76
R0090:Folh1	UTSW	7	86725868	splice site	probably benign
R0285:Folh1	UTSW	7	86742165	splice site	probably benign
R0482:Folh1	UTSW	7	86746101	splice site	probably benign
R0492:Folh1	UTSW	7	86746192	missense	probably damaging	1.00
R1079:Folh1	UTSW	7	86771881	missense	probably damaging	1.00
R1148:Folh1	UTSW	7	86761730	missense	probably damaging	1.00
R1148:Folh1	UTSW	7	86761730	missense	probably damaging	1.00
R1493:Folh1	UTSW	7	86761730	missense	probably damaging	1.00
R1778:Folh1	UTSW	7	86761699	critical splice donor site	probably null
R1865:Folh1	UTSW	7	86725906	missense	possibly damaging	0.65
R1878:Folh1	UTSW	7	86771742	missense	probably benign
R1906:Folh1	UTSW	7	86742166	splice site	probably null
R1912:Folh1	UTSW	7	86762967	missense	possibly damaging	0.95
R3001:Folh1	UTSW	7	86723311	missense	probably damaging	1.00
R3002:Folh1	UTSW	7	86723311	missense	probably damaging	1.00
R3883:Folh1	UTSW	7	86775656	missense	possibly damaging	0.48
R4061:Folh1	UTSW	7	86756962	missense	possibly damaging	0.49
R4277:Folh1	UTSW	7	86762915	critical splice donor site	probably null
R4507:Folh1	UTSW	7	86757008	missense	probably benign
R4627:Folh1	UTSW	7	86773252	missense	probably benign	0.00
R4652:Folh1	UTSW	7	86744425	nonsense	probably null
R4653:Folh1	UTSW	7	86744425	nonsense	probably null
R4745:Folh1	UTSW	7	86723274	critical splice donor site	probably null
R5571:Folh1	UTSW	7	86734120	missense	probably damaging	1.00
R6000:Folh1	UTSW	7	86725934	missense	probably benign	0.01
R6307:Folh1	UTSW	7	86723309	missense	probably damaging	1.00
R6474:Folh1	UTSW	7	86775756	missense	probably damaging	0.99
R7112:Folh1	UTSW	7	86775637	critical splice donor site	probably null
R7131:Folh1	UTSW	7	86726112	missense	probably damaging	1.00
R7449:Folh1	UTSW	7	86731748	missense	probably benign	0.00
R7494:Folh1	UTSW	7	86719699	missense	probably damaging	1.00
R7539:Folh1	UTSW	7	86725909	missense	probably benign	0.35
R7764:Folh1	UTSW	7	86762918	missense	probably benign
R7803:Folh1	UTSW	7	86726098	missense	probably damaging	1.00
RF007:Folh1	UTSW	7	86775687	missense	probably benign
Z1088:Folh1	UTSW	7	86725954	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCAGCTGTGTTCCATAAGG -3'
(R):5'- CTTATTCAAGCCAGGAAATCAGG -3'

Sequencing Primer
(F):5'- TTGTCTGATACTGTCAAATGTATCAC -3'
(R):5'- ATCAGGAGTATGACATGTGTGTATAG -3'

Posted On

2014-10-16