Incidental Mutation 'R2263:Ubqln3'
ID 243925
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 040263-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R2263 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 103790842 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 416 (L416*)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably null
Transcript: ENSMUST00000057254
AA Change: L416*
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: L416*

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,224,702 (GRCm39) S472P probably benign Het
Armh3 A G 19: 45,920,788 (GRCm39) probably null Het
Arsi T C 18: 61,049,737 (GRCm39) Y207H probably damaging Het
Atp2b4 C T 1: 133,654,271 (GRCm39) R778Q probably benign Het
Bdp1 T A 13: 100,202,545 (GRCm39) D693V probably damaging Het
Car12 C A 9: 66,654,913 (GRCm39) Y114* probably null Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col4a1 A G 8: 11,362,586 (GRCm39) probably benign Het
Cryl1 G T 14: 57,523,865 (GRCm39) Y232* probably null Het
Dnah11 T A 12: 117,843,760 (GRCm39) M4362L probably benign Het
Dnah11 T C 12: 117,930,374 (GRCm39) T3324A probably damaging Het
Dnah8 A G 17: 30,892,809 (GRCm39) N798S probably damaging Het
Dok4 A T 8: 95,593,140 (GRCm39) C182S probably damaging Het
Ehbp1 A T 11: 22,045,462 (GRCm39) N737K probably benign Het
Eif2b4 T C 5: 31,349,918 (GRCm39) probably benign Het
Elp1 A G 4: 56,755,298 (GRCm39) probably null Het
Fat4 T C 3: 38,943,138 (GRCm39) V677A possibly damaging Het
Fbn2 A G 18: 58,228,248 (GRCm39) probably benign Het
Fbxl3 G T 14: 103,320,648 (GRCm39) Y314* probably null Het
Fgf12 T A 16: 28,008,363 (GRCm39) K84* probably null Het
Flt3 G A 5: 147,284,873 (GRCm39) P748L probably benign Het
Folh1 C T 7: 86,368,973 (GRCm39) S685N probably benign Het
Gpr65 A T 12: 98,241,494 (GRCm39) N49I probably damaging Het
Hdac7 A G 15: 97,708,732 (GRCm39) probably null Het
Heatr5a A T 12: 51,962,933 (GRCm39) V989E probably damaging Het
Kif12 A G 4: 63,087,758 (GRCm39) S242P probably benign Het
Ltbp3 G A 19: 5,804,050 (GRCm39) R854Q probably benign Het
Mia3 A G 1: 183,115,647 (GRCm39) Y295H probably benign Het
Nell1 C T 7: 50,210,569 (GRCm39) T494I possibly damaging Het
Nmur2 A T 11: 55,920,387 (GRCm39) V286E probably damaging Het
Or1ad6 G A 11: 50,860,696 (GRCm39) V284I possibly damaging Het
Or1e1 T A 11: 73,245,131 (GRCm39) L184Q possibly damaging Het
Or51t4 T C 7: 102,598,464 (GRCm39) F254S probably damaging Het
Pcdh1 A T 18: 38,331,710 (GRCm39) L431H probably benign Het
Pramel31 A G 4: 144,090,111 (GRCm39) I384V probably benign Het
Prex1 A T 2: 166,430,988 (GRCm39) probably benign Het
Prim1 T A 10: 127,851,132 (GRCm39) D5E probably benign Het
Rubcnl A T 14: 75,278,260 (GRCm39) N348I possibly damaging Het
Shisa9 G T 16: 11,802,631 (GRCm39) A63S possibly damaging Het
Shpk G A 11: 73,097,319 (GRCm39) probably benign Het
Slx4ip T C 2: 136,885,935 (GRCm39) I85T probably damaging Het
Sptbn4 T A 7: 27,133,782 (GRCm39) D77V probably damaging Het
Strn3 A T 12: 51,690,006 (GRCm39) probably null Het
Synrg T C 11: 83,867,978 (GRCm39) M61T possibly damaging Het
Tekt4 T A 17: 25,695,485 (GRCm39) S439R possibly damaging Het
Ticam1 A T 17: 56,578,888 (GRCm39) V69E possibly damaging Het
Trpv1 C T 11: 73,132,508 (GRCm39) A374V probably damaging Het
Uqcrfs1 G A 13: 30,725,090 (GRCm39) S150L probably benign Het
Utp15 T C 13: 98,394,433 (GRCm39) N153S probably benign Het
Vmn2r63 G T 7: 42,578,031 (GRCm39) T169N probably benign Het
Vps13b T A 15: 35,646,327 (GRCm39) V1477E probably benign Het
Wdr87-ps T C 7: 29,231,987 (GRCm39) noncoding transcript Het
Xpo1 T A 11: 23,234,634 (GRCm39) probably null Het
Xpo5 A G 17: 46,541,269 (GRCm39) I769V probably benign Het
Zc3h14 A T 12: 98,724,773 (GRCm39) H252L probably benign Het
Zfp410 G T 12: 84,369,794 (GRCm39) probably null Het
Zfp521 T C 18: 13,979,297 (GRCm39) E372G possibly damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCAGGAGTAGCTGACATAAGG -3'
(R):5'- AGCTTTCTGGGTAACATAGGACTC -3'

Sequencing Primer
(F):5'- TAGCTGACATAAGGGAAGATGGTG -3'
(R):5'- CTTCAACAGTTACATGAGACTTCTC -3'
Posted On 2014-10-16