Mutagenetix > Incidental Mutations

Incidental Mutation 'R2263:Ubqln3'

243925

Institutional Source

Beutler Lab

Gene Symbol

Ubqln3

Ensembl Gene

ENSMUSG00000051618

Gene Name

ubiquilin 3

Synonyms

4933400K24Rik

MMRRC Submission

040263-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R2263 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104140623-104143279 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 104141635 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 416 (L416*)

Ref Sequence

ENSEMBL: ENSMUSP00000055229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]

Predicted Effect

probably null
Transcript: ENSMUST00000057254
AA Change: L416*

SMART Domains

Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: L416*

Domain	Start	End	E-Value	Type
UBQ	22	92	1.56e-15	SMART
low complexity region	103	115	N/A	INTRINSIC
low complexity region	120	151	N/A	INTRINSIC
STI1	194	233	4.25e-7	SMART
low complexity region	280	291	N/A	INTRINSIC
low complexity region	313	328	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
UBA	619	657	4.22e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138055

SMART Domains

Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	T	C	7: 29,532,562		noncoding transcript	Het
9130011E15Rik	A	G	19: 45,932,349		probably null	Het
Abca13	T	C	11: 9,274,702	S472P	probably benign	Het
Arsi	T	C	18: 60,916,665	Y207H	probably damaging	Het
Atp2b4	C	T	1: 133,726,533	R778Q	probably benign	Het
Bdp1	T	A	13: 100,066,037	D693V	probably damaging	Het
Car12	C	A	9: 66,747,631	Y114*	probably null	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col4a1	A	G	8: 11,312,586		probably benign	Het
Cryl1	G	T	14: 57,286,408	Y232*	probably null	Het
Dnah11	T	A	12: 117,880,025	M4362L	probably benign	Het
Dnah11	T	C	12: 117,966,639	T3324A	probably damaging	Het
Dnah8	A	G	17: 30,673,835	N798S	probably damaging	Het
Dok4	A	T	8: 94,866,512	C182S	probably damaging	Het
Ehbp1	A	T	11: 22,095,462	N737K	probably benign	Het
Eif2b4	T	C	5: 31,192,574		probably benign	Het
Fat4	T	C	3: 38,888,989	V677A	possibly damaging	Het
Fbn2	A	G	18: 58,095,176		probably benign	Het
Fbxl3	G	T	14: 103,083,212	Y314*	probably null	Het
Fgf12	T	A	16: 28,189,611	K84*	probably null	Het
Flt3	G	A	5: 147,348,063	P748L	probably benign	Het
Folh1	C	T	7: 86,719,765	S685N	probably benign	Het
Gm13119	A	G	4: 144,363,541	I384V	probably benign	Het
Gpr65	A	T	12: 98,275,235	N49I	probably damaging	Het
Hdac7	A	G	15: 97,810,851		probably null	Het
Heatr5a	A	T	12: 51,916,150	V989E	probably damaging	Het
Ikbkap	A	G	4: 56,755,298		probably null	Het
Kif12	A	G	4: 63,169,521	S242P	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Mia3	A	G	1: 183,334,793	Y295H	probably benign	Het
Nell1	C	T	7: 50,560,821	T494I	possibly damaging	Het
Nmur2	A	T	11: 56,029,561	V286E	probably damaging	Het
Olfr1378	G	A	11: 50,969,869	V284I	possibly damaging	Het
Olfr20	T	A	11: 73,354,305	L184Q	possibly damaging	Het
Olfr574	T	C	7: 102,949,257	F254S	probably damaging	Het
Pcdh1	A	T	18: 38,198,657	L431H	probably benign	Het
Prex1	A	T	2: 166,589,068		probably benign	Het
Prim1	T	A	10: 128,015,263	D5E	probably benign	Het
Rubcnl	A	T	14: 75,040,820	N348I	possibly damaging	Het
Shisa9	G	T	16: 11,984,767	A63S	possibly damaging	Het
Shpk	G	A	11: 73,206,493		probably benign	Het
Slx4ip	T	C	2: 137,044,015	I85T	probably damaging	Het
Sptbn4	T	A	7: 27,434,357	D77V	probably damaging	Het
Strn3	A	T	12: 51,643,223		probably null	Het
Synrg	T	C	11: 83,977,152	M61T	possibly damaging	Het
Tekt4	T	A	17: 25,476,511	S439R	possibly damaging	Het
Ticam1	A	T	17: 56,271,888	V69E	possibly damaging	Het
Trpv1	C	T	11: 73,241,682	A374V	probably damaging	Het
Uqcrfs1	G	A	13: 30,541,107	S150L	probably benign	Het
Utp15	T	C	13: 98,257,925	N153S	probably benign	Het
Vmn2r63	G	T	7: 42,928,607	T169N	probably benign	Het
Vps13b	T	A	15: 35,646,181	V1477E	probably benign	Het
Xpo1	T	A	11: 23,284,634		probably null	Het
Xpo5	A	G	17: 46,230,343	I769V	probably benign	Het
Zc3h14	A	T	12: 98,758,514	H252L	probably benign	Het
Zfp410	G	T	12: 84,323,020		probably null	Het
Zfp521	T	C	18: 13,846,240	E372G	possibly damaging	Het

Other mutations in Ubqln3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ubqln3	APN	7	104141777	missense	probably benign	0.00
IGL00766:Ubqln3	APN	7	104142824	missense	probably benign	0.00
IGL01451:Ubqln3	APN	7	104142196	missense	possibly damaging	0.71
IGL01673:Ubqln3	APN	7	104142398	missense	probably benign	0.12
IGL01705:Ubqln3	APN	7	104142677	missense	probably damaging	1.00
IGL01988:Ubqln3	APN	7	104142882	utr 5 prime	probably benign
IGL02008:Ubqln3	APN	7	104142316	missense	probably damaging	1.00
IGL02072:Ubqln3	APN	7	104141299	missense	possibly damaging	0.69
IGL02546:Ubqln3	APN	7	104142518	missense	probably benign	0.02
IGL02657:Ubqln3	APN	7	104141963	missense	probably damaging	0.97
IGL02682:Ubqln3	APN	7	104142065	missense	probably benign	0.19
IGL02709:Ubqln3	APN	7	104141336	missense	probably benign	0.12
IGL03357:Ubqln3	APN	7	104142556	missense	probably benign
PIT4544001:Ubqln3	UTSW	7	104141343	missense	probably damaging	0.97
R0180:Ubqln3	UTSW	7	104141840	missense	probably damaging	1.00
R0845:Ubqln3	UTSW	7	104142068	missense	probably damaging	0.98
R1019:Ubqln3	UTSW	7	104141386	missense	probably benign	0.00
R1280:Ubqln3	UTSW	7	104142076	missense	possibly damaging	0.85
R1448:Ubqln3	UTSW	7	104142790	missense	probably damaging	1.00
R1550:Ubqln3	UTSW	7	104141546	missense	probably damaging	0.98
R1617:Ubqln3	UTSW	7	104142860	missense	possibly damaging	0.95
R1650:Ubqln3	UTSW	7	104141021	missense	possibly damaging	0.84
R2060:Ubqln3	UTSW	7	104142151	missense	probably damaging	1.00
R2246:Ubqln3	UTSW	7	104142311	missense	probably damaging	1.00
R2366:Ubqln3	UTSW	7	104141049	missense	probably damaging	0.99
R4232:Ubqln3	UTSW	7	104141803	missense	probably benign	0.00
R4447:Ubqln3	UTSW	7	104142814	missense	probably benign	0.31
R4509:Ubqln3	UTSW	7	104141444	missense	probably damaging	0.97
R4604:Ubqln3	UTSW	7	104142491	missense	probably benign	0.00
R5416:Ubqln3	UTSW	7	104141672	missense	probably benign	0.34
R5617:Ubqln3	UTSW	7	104142433	missense	probably damaging	0.99
R5648:Ubqln3	UTSW	7	104140910	missense	probably damaging	0.99
R5722:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5723:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5724:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5819:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5820:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5966:Ubqln3	UTSW	7	104141699	missense	probably benign	0.03
R6260:Ubqln3	UTSW	7	104142317	nonsense	probably null
R6272:Ubqln3	UTSW	7	104142178	missense	probably damaging	1.00
R6542:Ubqln3	UTSW	7	104141617	missense	probably benign	0.00
R6936:Ubqln3	UTSW	7	104142310	missense	probably damaging	1.00
R7023:Ubqln3	UTSW	7	104141423	missense	probably damaging	1.00
R7025:Ubqln3	UTSW	7	104141275	missense	probably benign	0.01
R7079:Ubqln3	UTSW	7	104141371	missense	probably benign	0.12
R7733:Ubqln3	UTSW	7	104141076	missense	probably damaging	0.98
R7764:Ubqln3	UTSW	7	104141236	missense	possibly damaging	0.52
R7919:Ubqln3	UTSW	7	104141192	missense	probably benign	0.03
R7961:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R8009:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
RF054:Ubqln3	UTSW	7	104141178	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAGGAGTAGCTGACATAAGG -3'
(R):5'- AGCTTTCTGGGTAACATAGGACTC -3'

Sequencing Primer
(F):5'- TAGCTGACATAAGGGAAGATGGTG -3'
(R):5'- CTTCAACAGTTACATGAGACTTCTC -3'

Posted On

2014-10-16