Incidental Mutation 'R2263:Prim1'
ID243928
Institutional Source Beutler Lab
Gene Symbol Prim1
Ensembl Gene ENSMUSG00000025395
Gene NameDNA primase, p49 subunit
Synonyms
MMRRC Submission 040263-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R2263 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128015168-128030037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128015263 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 5 (D5E)
Ref Sequence ENSEMBL: ENSMUSP00000136556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026461] [ENSMUST00000178041]
Predicted Effect probably benign
Transcript: ENSMUST00000026461
AA Change: D5E

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026461
Gene: ENSMUSG00000025395
AA Change: D5E

DomainStartEndE-ValueType
Pfam:DNA_primase_S 108 336 9.7e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135580
Predicted Effect probably benign
Transcript: ENSMUST00000178041
AA Change: D5E

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136556
Gene: ENSMUSG00000025395
AA Change: D5E

DomainStartEndE-ValueType
Pfam:DNA_primase_S 108 336 3.3e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219845
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The replication of DNA in eukaryotic cells is carried out by a complex chromosomal replication apparatus, in which DNA polymerase alpha and primase are two key enzymatic components. Primase, which is a heterodimer of a small subunit and a large subunit, synthesizes small RNA primers for the Okazaki fragments made during discontinuous DNA replication. The protein encoded by this gene is the small, 49 kDa primase subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
9130011E15Rik A G 19: 45,932,349 probably null Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Cryl1 G T 14: 57,286,408 Y232* probably null Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Fgf12 T A 16: 28,189,611 K84* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr1378 G A 11: 50,969,869 V284I possibly damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prex1 A T 2: 166,589,068 probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Slx4ip T C 2: 137,044,015 I85T probably damaging Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in Prim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Prim1 APN 10 128029243 missense probably benign
IGL01896:Prim1 APN 10 128022889 missense probably damaging 1.00
IGL02505:Prim1 APN 10 128029783 makesense probably null
PIT4403001:Prim1 UTSW 10 128022876 missense probably benign 0.01
R0563:Prim1 UTSW 10 128026554 missense probably damaging 1.00
R1732:Prim1 UTSW 10 128015324 missense probably damaging 1.00
R1976:Prim1 UTSW 10 128023799 missense probably benign
R4774:Prim1 UTSW 10 128027018 intron probably benign
R4976:Prim1 UTSW 10 128015262 missense probably damaging 0.97
R5908:Prim1 UTSW 10 128018024 missense probably damaging 1.00
R6356:Prim1 UTSW 10 128023835 missense probably damaging 0.97
R6598:Prim1 UTSW 10 128020180 missense possibly damaging 0.83
R6794:Prim1 UTSW 10 128018149 missense probably damaging 0.97
R7179:Prim1 UTSW 10 128015976 missense probably damaging 1.00
R7325:Prim1 UTSW 10 128022919 missense probably null 0.13
R7432:Prim1 UTSW 10 128016016 missense probably damaging 1.00
R7542:Prim1 UTSW 10 128018034 missense probably damaging 1.00
R7659:Prim1 UTSW 10 128026589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGATAGGTTTTCAGAGCCCG -3'
(R):5'- AAGAAGGTGCCTCTCTTCTTC -3'

Sequencing Primer
(F):5'- TTTTCAGAGCCCGGAAGATGC -3'
(R):5'- GAAGGTGCCTCTCTTCTTCCTAGG -3'
Posted On2014-10-16